| Title: | Applied Statistical Time Series Analysis |
|---|---|
| Description: | Contains data sets and scripts for analyzing time series in both the frequency and time domains including state space modeling as well as supporting the texts Time Series Analysis and Its Applications: With R Examples (5th ed), by R.H. Shumway and D.S. Stoffer. Springer Texts in Statistics, 2025, <DOI:10.1007/978-3-031-70584-7>, and Time Series: A Data Analysis Approach Using R (2nd ed). Chapman-Hall, 2026, <https://www.routledge.com/Time-Series-A-Data-Analysis-Approach-Using-R/Shumway-Stoffer/p/book/9781041031642>. Most scripts are designed to require minimal input to produce aesthetically pleasing output for ease of use in live demonstrations and course work. |
| Authors: | David Stoffer [aut, cre], Nicky Poison [ctb, mus, spy] |
| Maintainer: | David Stoffer <[email protected]> |
| License: | GPL (>= 2) |
| Version: | 2.5 |
| Built: | 2026-07-09 07:01:19 UTC |
| Source: | https://github.com/cran/astsa |
Contains data sets and scripts for analyzing time series in both the frequency and time domains including state space modeling as well as supporting the texts Time Series Analysis and Its Applications: With R Examples (5th ed, 2025) and Time Series: A Data Analysis Approach Using R, (2nd ed, 2026). Most scripts are designed to need minimal input to produce aesthetically pleasing output for ease of use in live demonstrations and in course work.
| Package: | astsa |
| Type: | Package |
| Version: | 2.5 |
| Date: | 2026-03-13 |
| License: | GPL (>= 2) |
| LazyLoad: | yes |
| LazyData: | yes |
If the package dplyr is loaded, it will mask the base scripts filter and lag (among other things) that a time series analyst uses often. In this case, whenever you analyze time series data, we suggest you either:
(1) Detach it if it's loaded but not being used:
detach(package:dplyr)
(2) If you want to use it, fix it:
library(dplyr, exclude = c("filter", "lag")) # load it without the culprits
dlag = dplyr::lag # and fix ...
dfilter = dplyr::filter # ... the blunders
then use dlag and dfilter for dplyr scripts
and lag and filter can be use as originally intended.
(3) Or just take back the commands:
filter = stats::filter lag = stats::lag
and you can still use these for dpylr:
dlag = dplyr::lag dfilter = dplyr::filter
(4) Or avoid all of these problems and use
data.table instead of
dplyr. If you are doing data manipulation, you should know that
dplyr is inspired by data.table, but it
is much slower and weaker than data.table.
David Stoffer <[email protected]>
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
Produces a plot (and a printout) of the sample ACF or PACF. The zero lag value of the ACF is removed.
acf1(series, max.lag = NULL, plot = TRUE, main = NULL, ylim = NULL, pacf = FALSE, ylab = NULL, xlab = NULL, na.action = na.pass, ...)acf1(series, max.lag = NULL, plot = TRUE, main = NULL, ylim = NULL, pacf = FALSE, ylab = NULL, xlab = NULL, na.action = na.pass, ...)
series |
The data (must be more than 2 observations). Does not have to be a time series object. |
max.lag |
Maximum lag. Can be omitted. Unless |
plot |
If TRUE (default), a graph is produced and the values are rounded and listed. If FALSE, no graph is produced and the values are listed but not rounded by the script. |
main |
Title of graphic; defaults to name of series. |
ylim |
Specify limits for the y-axis. |
pacf |
If TRUE, the sample PACF is returned instead of ACF. |
ylab |
Change y-axis label from default. |
xlab |
Change x-axis label from default. |
na.action |
How to handle missing data; default is |
... |
Additional arguments passed to |
Will print and/or plot the sample ACF or PACF (if pacf=TRUE). The zero lag of the ACF (which is always 1) has been removed. If plot=TRUE, a graph is produced and the values are rounded and listed. If plot=FALSE, no graph is produced and the values are listed but not rounded by the script. The error bounds are approximate white noise bounds, ; no other option is given.
ACF |
The sample ACF or PACF |
D.S. Stoffer
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
acf1(rnorm(100)) acf1(sarima.sim(ar=.9), pacf=TRUE) acf1(soi, col=2:7, lwd=4, gg=TRUE)acf1(rnorm(100)) acf1(sarima.sim(ar=.9), pacf=TRUE) acf1(soi, col=2:7, lwd=4, gg=TRUE)
Produces a simultaneous plot (and a printout) of the sample ACF and PACF on the same scale. The zero lag value of the ACF is removed.
acf2(series, max.lag = NULL, plot = TRUE, main = NULL, ylim = NULL, na.action = na.pass, ...)acf2(series, max.lag = NULL, plot = TRUE, main = NULL, ylim = NULL, na.action = na.pass, ...)
series |
The data (must be more than 2 observations). Does not have to be a time series object. |
max.lag |
Maximum lag. Can be omitted. Defaults to |
plot |
If TRUE (default), a graph is produced and the values are rounded and listed. If FALSE, no graph is produced and the values are listed but not rounded by the script. |
main |
Title of graphic; defaults to name of series. |
ylim |
Specify limits for the y-axis. |
na.action |
How to handle missing data; default is |
... |
Additional arguments passed to |
Will print and/or plot the sample ACF and PACF on the same scale. The zero lag of the ACF (which is always 1) has been removed. If plot=TRUE, a graph is produced and the values are rounded and listed. If plot=FALSE, no graph is produced and the values are listed but not rounded by the script. The error bounds are approximate white noise bounds, ; no other option is given.
ACF |
The sample ACF |
PACF |
The sample PACF |
D.S. Stoffer
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
acf2(rnorm(100)) acf2(rnorm(100), 25, main=NA) # no title acf2(rnorm(100), max.lag=5, plot=FALSE) # print only acf2(soi, col=2:7, lwd=4, gg=TRUE)acf2(rnorm(100)) acf2(rnorm(100), 25, main=NA) # no title acf2(rnorm(100), max.lag=5, plot=FALSE) # print only acf2(soi, col=2:7, lwd=4, gg=TRUE)
Produces a grid of plots of the sample ACF (diagonal) and CCF (off-diagonal). The values are returned invisibly.
acfm(series, max.lag = NULL, na.action = na.pass, ylim = NULL, acf.highlight = TRUE, plot = TRUE, ...)acfm(series, max.lag = NULL, na.action = na.pass, ylim = NULL, acf.highlight = TRUE, plot = TRUE, ...)
series |
Multiple time series (at least 2 columns of time series with more than 3 observations). |
max.lag |
Maximum lag. Can be omitted. Unless |
na.action |
How to handle missing data; default is |
ylim |
Specify limits for the all correlation axes. If NULL (default) the values are a little wider than the min and max of all values. |
acf.highlight |
If TRUE (default), the diagonals (ACFs) are highlighted. |
plot |
If TRUE (default), you get a wonderful graphic. |
... |
Additional arguments passed to |
Produces a grid of plots of the sample ACF (diagonal) and CCF (off-diagonal).
The plots in the grid are estimates of corr{x(t+LAG), y(t)}. Thus
x leads y if LAG is positive and x lags y if LAG is negative.
If plot is FALSE, then there is no graphic.
The correlations are returned invisibly.
D.S. Stoffer
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
acfm(diff(log(econ5)), gg=TRUE) acfm(diff(log(econ5)), 2, plot=FALSE)acfm(diff(log(econ5)), gg=TRUE) acfm(diff(log(econ5)), 2, plot=FALSE)
Performs a nonparametric bootstrap to obtain the distribution of the AR model parameters.
ar.boot(series, order.ar, nboot = 500, seed = NULL, plot = TRUE, ...)ar.boot(series, order.ar, nboot = 500, seed = NULL, plot = TRUE, ...)
series |
time series data (univariate only) |
order.ar |
autoregression order - must be specified |
nboot |
number of bootstrap iterations (default is 500) |
seed |
seed for the bootstrap sampling (defalut is NULL) |
plot |
if TRUE (default) and |
... |
if |
For a specified series, finds the bootstrap distribution of the
Yule-Walker estimates of in the AR model specified by order.ar,
where is white noise. The data are centered by the sample mean prior to the bootstrap simulations.
The script displays a number of quantiles of the bootstrapped estimates, the means, the biases, and the root mean squared errors.
Returned invisibly as a list:
phi.star |
[[1]] bootstrapped AR parameters |
x.sim |
[[2]] bootstrapped data |
mean.star |
[[3]] bootstrapped mean |
var.star |
[[4]] bootstrapped noise variance |
yw.fit |
[[5]] results of Yule-Walker fit to the data |
D.S. Stoffer
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
## Not run: u = ar.boot(rec, 2) dev.new() tspairs(u[[1]], hist=FALSE) # another view of results head(u[[1]]) # some booted AR parameters head(u[[2]][,1:5]) # some booted data ## End(Not run)## Not run: u = ar.boot(rec, 2) dev.new() tspairs(u[[1]], hist=FALSE) # another view of results head(u[[1]]) # some booted AR parameters head(u[[2]][,1:5]) # some booted data ## End(Not run)
Uses Gibbs sampling to fit an AR model to time series data.
ar.mcmc(xdata, porder, n.iter = 1000, n.warmup = 100, plot = TRUE, prior_var_phi = 50, prior_sig_a = 1, prior_sig_b = 2, ...)ar.mcmc(xdata, porder, n.iter = 1000, n.warmup = 100, plot = TRUE, prior_var_phi = 50, prior_sig_a = 1, prior_sig_b = 2, ...)
xdata |
time series data (univariate only) |
porder |
autoregression order |
n.iter |
number of iterations for the sampler |
n.warmup |
number of startup iterations for the sampler (these are removed) |
plot |
if TRUE (default) returns the draws after warmup (diagonal) and a scatterplot matrix of the draws (off-diagonal) |
prior_var_phi |
prior variance of the vector of AR coefficients; see details |
prior_sig_a |
first prior for the variance component; see details |
prior_sig_b |
second prior for the variance component; see details |
... |
additional graphic parameters passed to |
Assumes a normal-inverse gamma model,
where is standard Gaussian noise.
With being the (p+1)-dimensional vector of the s,
the priors are
and
, where .
Defaults are given for the hyperparameters, but the user
may choose as (prior_sig_a, prior_sig_b)
and as prior_var_phi.
The algorithm is efficient and converges quickly. Further details can be found in Chapter 6 of the 5th edition of the Springer text.
In addition to the graphics (if plot is TRUE),
the draws of each parameter (phi0, phi1, ..., sigma)
are returned invisibly and means, standard deviations, and
various quantiles are displayed.
D.S. Stoffer
Based on the script arp.mcmc used in Douc, Moulines, & Stoffer, D. (2014).
Nonlinear Time Series: Theory, Methods and Applications with R Examples. CRC press.
ISBN 9781466502253.
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
## Not run: u = ar.mcmc(rec, 2) tspairs(u, hist=FALSE, col.diag=6) # another view tsplot(u, ncol=2, col=4, xlab='Index') # traces only ## End(Not run)## Not run: u = ar.mcmc(rec, 2) tspairs(u, hist=FALSE, col.diag=6) # another view tsplot(u, ncol=2, col=4, xlab='Index') # traces only ## End(Not run)
Data used in Chapter 6 Problems
The format is: Time-Series [1:100] with NA for missing values.
Simulated AR(1) with and and ~10% of the values missing at random (in this case, there happen to be 15 missing values). A similar data set can be generated as follows:
x = sarima.sim(ar=.9, n=100) u = sample(c(NA,0), replace=TRUE, size=100, prob=c(.1,.9)) arm = x + u
Another approach if you want exactly 10 missing values is this:
arms = sarima.sim(ar=.9, n=100) arms[sample(1:100, size=10)] = NA
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
# use type='o' when plotting a series with missing data par(mfrow=2:1) tsplot(ar1miss, col=4) tsplot(ar1miss, col=4, type='o', pch=19)# use type='o' when plotting a series with missing data par(mfrow=2:1) tsplot(ar1miss, col=4) tsplot(ar1miss, col=4, type='o', pch=19)
1000 simulated observations from an ARFIMA(1, 1, 0) model with and .
The format is: Time-Series [1:1000] from 1 to 1000: -0.0294 0.7487 -0.3386 -1.0332 -0.2627 ...
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
par(mfrow=2:1) tsplot(arf, col=4, main='ARFIMA') acf1(arf, col=4, main=NA)par(mfrow=2:1) tsplot(arf, col=4, main='ARFIMA') acf1(arf, col=4, main=NA)
For a given ARMA model (including seasonal models), reports whether the model is causal, invertible, or (approximately) over-parameterized.
arma.check(ar = 0, ma = 0, sar = NULL, sma = NULL, S = NULL, redtol = 0.1, plot.it = FALSE, ...)arma.check(ar = 0, ma = 0, sar = NULL, sma = NULL, S = NULL, redtol = 0.1, plot.it = FALSE, ...)
ar |
vector of AR parameters |
ma |
vector of MA parameters |
sar |
vector of seasonal AR parameters (only specify for seasonal models) |
sma |
vector of seasonal MA parameters (only specify for seasonal models) |
S |
seasonal period (only specify for seasonal models - default value is 12) |
redtol |
tolerance for reporting parameter redundancy |
plot.it |
if TRUE -and- the model is causal and invertible, will plot the inverse roots and display the redundancy tolerance level, but ONLY for the AR and MA parts (seasonal parts are ignored) |
... |
additional graphical parameters |
Causality and invertibility are checked first. If either one or both are reported, checking is stopped.
If the model is causal and invertible, a warning for (possible) over-parameterization/redundancy is given if there are (approximate) common zeros.
To evaluate parameter redundancy, the inverse roots of the AR and MA polynomials are examined for closeness with redtol determining closeness; see the note.
For fun, and IF the model is causal and invertible, setting plot.it=TRUE will display the complex plane with the inverse roots of the AR and MA polynomials displayed with colored arrows; the seasonal components are not included because it's too messy. The tolerance level for declaring over-parameterization is also displayed in the graphic.
See the details. If the model is causal and invertible and not over-parameterized, a nice message of validation is given. Otherwise, problems are reported but the specific culprits may not be specified.
The Fisher Information matrix for ARMA is singular for exact redundancy, and its closeness to singularity can be measured by the closeness of the inverse of those roots [e.g., Klein and Spreij (1997). On Fisher's information matrix of an ARMA process. In Stochastic Differential and Difference Equations, 273-284. Boston: Birkhauser.]
D.S. Stoffer
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
arma.spec, sarima.sim, ARMAtoAR, ARMAtoMA
arma.check(ar=c(1,-.9), sar=-.6, sma=-.4, S=4) arma.check(ar=.9, ma=c(-.9,-.8), sar=1, S=12) # hard to tell from parameters alone ... arma.check(ar=c(1.5,-.75), ma=c(-.6,-.3,.45), plot.it=TRUE, gg=TRUE)arma.check(ar=c(1,-.9), sar=-.6, sma=-.4, S=4) arma.check(ar=.9, ma=c(-.9,-.8), sar=1, S=12) # hard to tell from parameters alone ... arma.check(ar=c(1.5,-.75), ma=c(-.6,-.3,.45), plot.it=TRUE, gg=TRUE)
Gives the ARMA model spectrum, but first tests for causality and invertibility, and then for parameter redundancy.
arma.spec(ar = 0, ma = 0, var.noise = 1, n.freq = 500, main = NULL, redundancy.tol=.1, frequency = 1, ylim = NULL, plot = TRUE, ...)arma.spec(ar = 0, ma = 0, var.noise = 1, n.freq = 500, main = NULL, redundancy.tol=.1, frequency = 1, ylim = NULL, plot = TRUE, ...)
ar |
vector of AR parameters |
ma |
vector of MA parameters |
var.noise |
variance of the noise |
n.freq |
number of frequencies |
main |
title of graphic; default is "ARMA" with orders "(p, q)" |
redundancy.tol |
tolerance for reporting parameter redundancy |
frequency |
for plotting, adjusts the frequency axis units |
ylim |
optional; specify limits for the y-axis |
plot |
if TRUE (default), produces a graphic |
... |
additional arguments for the graphic |
The basic call is arma.spec(ar, ma) where ar and ma are vectors
containing the model parameters. Use log='y' if you want the plot on a log scale.
If the model is not causal or invertible, a stop error with a message is given; e.g., arma.spec(ar=1, ma=1) will just produce warnings.
If there are (approximate) common zeros, a spectrum will be displayed and a warning will be given;
e.g., arma.spec(ar= .9, ma= -.9) will yield a warning and the plot will be the
spectrum of white noise. See arma.check for details on the evaluation of parameter redundancy.
freq |
frequencies - returned invisibly |
spec |
spectral ordinates - returned invisibly |
D.S. Stoffer
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
arma.spec(ar = c(1, -.9), ma = .8) arma.spec(ar = c(1, -.9), log='y') arma.spec(ar = -.9, ma=.89, gg=TRUE) # almost white noise # if you want a seasonal model, you have to be a little clever arma.spec(ar=c(rep(0,11),.4), ma=.5, col=5, lwd=3, frequency=12)arma.spec(ar = c(1, -.9), ma = .8) arma.spec(ar = c(1, -.9), log='y') arma.spec(ar = -.9, ma=.89, gg=TRUE) # almost white noise # if you want a seasonal model, you have to be a little clever arma.spec(ar=c(rep(0,11),.4), ma=.5, col=5, lwd=3, frequency=12)
Gives the -weights in the invertible representation of an ARMA model.
ARMAtoAR(ar = 0, ma = 0, lag.max=20)ARMAtoAR(ar = 0, ma = 0, lag.max=20)
ar |
vector of AR coefficients |
ma |
vector of MA coefficients |
lag.max |
number of pi-weights desired |
A vector of coefficients. For an ARMA model , returns the
coefficients in the invertible representation
where .
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
ARMAtoAR(ar=.9, ma=.5, 10)ARMAtoAR(ar=.9, ma=.5, 10)
The script does one of two things. [1] Easily modify the opacity level of the astsa colors. [2] Create a color wheel of a chosen number of colors from a base color.
astsa.col(col=1, alpha=1, wheel=FALSE, pie=FALSE, num, sat=NULL, val=NULL, ...)astsa.col(col=1, alpha=1, wheel=FALSE, pie=FALSE, num, sat=NULL, val=NULL, ...)
col |
Either
- see Examples |
alpha |
factor in [0, 1] setting the opacity of all colors. Smaller values are more transparent. |
wheel |
if TRUE, produces a color wheel of |
pie |
if TRUE, produces a pie chart of the chosen colors. |
num |
an integer specifying the number of desired colors in the wheel. If missing, the user is prompted to enter a number. |
sat |
factor in [0, 1] setting the 'saturation' (intensity) of the colors. If NULL, the saturation from the base color is used. |
val |
factor in [0, 1] setting the 'value' (brightness) of the colors. If NULL, the value from the base color is used. |
... |
other graphical parameters for the pie chart; see |
The astsa color palette is attached when the package is attached.
The colors follow the R pattern of shades of: (1) black, (2) red, (3) green, (4) blue,
(5) cyan, (6) magenta, (7) gold, (8) gray. The opacity of these colors can be
changed easily using this script. Values are recycled, e.g., col=9 is
the same as col=1.
Additionally, a color wheel can be generated by specifying a base color and inputting
the number of desired colors. Using hsv, the script moves the 'hue' around
the circle in equal steps holding 'saturation' and 'value' constant. This may be overridden
by entering an alternate 'saturation' or 'value'.
In either application, a pie chart can be displayed to help in choosing the desired color scheme.
[1] a color vector using the astsa color palette at the chosen transparency level
- OR -
[2] a color wheel of a chosen number num of colors from a base color
D.S.Stoffer
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
# View the astsa palette astsa.col(1:8, pie=TRUE) legend('topright', legend=astsa.col(1:8), fill=1:8, title='Hex Color Code') # Plotting 2 series that touch (but in a nice way) tsplot(cbind(gtemp_land, gtemp_ocean), col=astsa.col(c(4,2), .5), lwd=2, spaghetti=TRUE, type='o', pch=20, ylab="Temperature Deviations", addLegend=TRUE, location='topleft', legend=c("Land Only", "Ocean Only"), gg=TRUE) # The hsv values for Dodgerblue3 (or astsa color 4)? rgb2hsv(col2rgb(4)) # Wheels of fortune vanna = par(no.readonly = TRUE) par(mar=rep(0, 4)) layout( matrix(c(1,3,2,3), 2) ) astsa.col(4, wheel=TRUE, num=8, pie=TRUE) astsa.col(4, wheel=TRUE, num=8, pie=TRUE, sat=.6, val=.9) astsa.col(2, wheel=TRUE, num=100, pie=TRUE, border=FALSE, labels=NA) # I'd like to solve the puzzle par(vanna) # reset graphic device x = replicate(6, sarima.sim(ar=c(1.5,-.75), n=120)) tsplot(x, spag=TRUE, col=astsa.col(4, alpha=.7, wheel=TRUE, num=6), lwd=12)# View the astsa palette astsa.col(1:8, pie=TRUE) legend('topright', legend=astsa.col(1:8), fill=1:8, title='Hex Color Code') # Plotting 2 series that touch (but in a nice way) tsplot(cbind(gtemp_land, gtemp_ocean), col=astsa.col(c(4,2), .5), lwd=2, spaghetti=TRUE, type='o', pch=20, ylab="Temperature Deviations", addLegend=TRUE, location='topleft', legend=c("Land Only", "Ocean Only"), gg=TRUE) # The hsv values for Dodgerblue3 (or astsa color 4)? rgb2hsv(col2rgb(4)) # Wheels of fortune vanna = par(no.readonly = TRUE) par(mar=rep(0, 4)) layout( matrix(c(1,3,2,3), 2) ) astsa.col(4, wheel=TRUE, num=8, pie=TRUE) astsa.col(4, wheel=TRUE, num=8, pie=TRUE, sat=.6, val=.9) astsa.col(2, wheel=TRUE, num=100, pie=TRUE, border=FALSE, labels=NA) # I'd like to solve the puzzle par(vanna) # reset graphic device x = replicate(6, sarima.sim(ar=c(1.5,-.75), n=120)) tsplot(x, spag=TRUE, col=astsa.col(4, alpha=.7, wheel=TRUE, num=6), lwd=12)
Uses minimum description length (MDL) to fit piecewise AR processes with the goal of detecting changepoints in time series. Optimization is accomplished via a genetic algorithm (GA).
autoParm(xdata, Pi.B = NULL, Pi.C = NULL, PopSize = 70, generation = 70, P0 = 20, Pi.P = 0.3, Pi.N = 0.3, NI = 7)autoParm(xdata, Pi.B = NULL, Pi.C = NULL, PopSize = 70, generation = 70, P0 = 20, Pi.P = 0.3, Pi.N = 0.3, NI = 7)
xdata |
time series (of length n at least 100) to be analyzed; the |
Pi.B |
probability of being a breakpoint in initial stage; default is 10/n. Does not need to be specified. |
Pi.C |
probability of conducting crossover; default is (n-10)/n. Does not need to be specified. |
PopSize |
population size (default is 70); the number of chromosomes in each generation. Does not need to be specified. |
generation |
number of iterations; default is 70. Does not need to be specified. |
P0 |
maximum AR order; default is 20. If larger than 20, it is reset to 20. Does not need to be specified. |
Pi.P |
probability of taking parent's gene in mutation; default is 0.3. Does not need to be specified. |
Pi.N |
probability of taking -1 in mutation; default is 0.3 Does not need to be specified. |
NI |
number if islands; default is 7. Does not need to be specified. |
Details my be found in Davis, Lee, & Rodriguez-Yam (2006). Structural break estimation for nonstationary time series models. JASA, 101, 223-239. doi:10.1198/016214505000000745
Returns three values, (1) the breakpoints including the endpoints, (2) the number of segments, and (3) the segment AR orders. See the examples.
The GA is a stochastic optimization procedure and consequently will give different results at each run. It is a good idea to run the algorithm a few times before coming to a final decision.
D.S. Stoffer
The code is adapted from R code provided to us by Rex Cheung (https://www.linkedin.com/in/rexcheung).
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
## Not run: ##-- simulation x1 = sarima.sim(ar=c(1.69, -.81), n=500) x2 = sarima.sim(ar=c(1.32, -.81), n=500) x = c(x1, x2) ##-- look at the data tsplot(x) ##-- run procedure autoParm(x) ##-- output (yours will be slightly different - ##-- the nature of GA) # returned breakpoints include the endpoints # $breakpoints # [1] 1 514 1000 # # $number_of_segments # [1] 2 # # $segment_AR_orders # [1] 2 2 ## End(Not run)## Not run: ##-- simulation x1 = sarima.sim(ar=c(1.69, -.81), n=500) x2 = sarima.sim(ar=c(1.32, -.81), n=500) x = c(x1, x2) ##-- look at the data tsplot(x) ##-- run procedure autoParm(x) ##-- output (yours will be slightly different - ##-- the nature of GA) # returned breakpoints include the endpoints # $breakpoints # [1] 1 514 1000 # # $number_of_segments # [1] 2 # # $segment_AR_orders # [1] 2 2 ## End(Not run)
Uses changepoint detection to discover if there have been slight changes in frequency in a time series. The autoSpec procedure uses minimum description length (MDL) to do nonparametric spectral estimation with the goal of detecting changepoints. Optimization is accomplished via a genetic algorithm (GA).
autoSpec(xdata, Pi.B = NULL, Pi.C = NULL, PopSize = 70, generation = 70, m0 = 10, Pi.P = 0.3, Pi.N = 0.3, NI = 7, taper = .5, min.freq = 0, max.freq = .5)autoSpec(xdata, Pi.B = NULL, Pi.C = NULL, PopSize = 70, generation = 70, m0 = 10, Pi.P = 0.3, Pi.N = 0.3, NI = 7, taper = .5, min.freq = 0, max.freq = .5)
xdata |
time series (of length n at least 100) to be analyzed; the |
Pi.B |
probability of being a breakpoint in initial stage; default is 10/n. Does not need to be specified. |
Pi.C |
probability of conducting crossover; default is (n-10)/n. Does not need to be specified. |
PopSize |
population size (default is 70); the number of chromosomes in each generation. Does not need to be specified. |
generation |
number of iterations; default is 70. Does not need to be specified. |
m0 |
maximum width of the Bartlett kernel is |
Pi.P |
probability of taking parent's gene in mutation; default is 0.3. Does not need to be specified. |
Pi.N |
probability of taking -1 in mutation; default is 0.3 Does not need to be specified. |
NI |
number if islands; default is 7. Does not need to be specified. |
taper |
half width of taper used in spectral estimate; .5 (default) is full taper. Does not need to be specified. |
min.freq, max.freq
|
the frequency range (min.freq, max.freq) over which to calculate the Whittle likelihood; the default is (0, .5). Does not need to be specified. If min > max, the roles are reversed, and reset to the default if either is out of range. |
Details my be found in Stoffer, D. S. (2023). AutoSpec: Detection of narrowband frequency changes in time series. Statistics and Its Interface, 16(1), 97-108. doi:10.4310/21-SII703
Returns three values, (1) the breakpoints including the endpoints, (2) the number of segments, and (3) the segment kernel orders. See the examples.
The GA is a stochastic optimization procedure and consequently will give different results at each run. It is a good idea to run the algorithm a few times before coming to a final decision.
D.S. Stoffer
The genetic algorithm code is adapted from R code provided to us by Rex Cheung (https://www.linkedin.com/in/rexcheung). The code originally supported Aue, Cheung, Lee, & Zhong (2014). Segmented model selection in quantile regression using the minimum description length principle. JASA, 109, 1241-1256. A similar version also supported Davis, Lee, & Rodriguez-Yam (2006). Structural break estimation for nonstationary time series models. JASA, 101, 223-239.
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
## Not run: ##-- simulation set.seed(1) num = 500 t = 1:num w = 2*pi/25 d = 2*pi/150 x1 = 2*cos(w*t)*cos(d*t) + rnorm(num) x2 = cos(w*t) + rnorm(num) x = c(x1,x2) ##-- plot and periodogram (all action below 0.1) tsplot(x, main='not easy to see the change') mvspec(x) ##-- run procedure autoSpec(x, max.freq=.1) ##-- output (yours will be slightly different - ##-- the nature of GA) # returned breakpoints include the endpoints # $breakpoints # [1] 1 503 1000 # # $number_of_segments # [1] 2 # # $segment_kernel_orders_m # [1] 2 4 ##-- plot everything par(mfrow=c(3,1)) tsplot(x, col=4) abline(v=503, col=6, lty=2, lwd=2) mvspec(x[1:502], kernel=bart(2), taper=.5, main='segment 1', col=4, xlim=c(0,.25)) mvspec(x[503:1000], kernel=bart(4), taper=.5, main='segment 2', col=4, xlim=c(0,.25)) ## End(Not run)## Not run: ##-- simulation set.seed(1) num = 500 t = 1:num w = 2*pi/25 d = 2*pi/150 x1 = 2*cos(w*t)*cos(d*t) + rnorm(num) x2 = cos(w*t) + rnorm(num) x = c(x1,x2) ##-- plot and periodogram (all action below 0.1) tsplot(x, main='not easy to see the change') mvspec(x) ##-- run procedure autoSpec(x, max.freq=.1) ##-- output (yours will be slightly different - ##-- the nature of GA) # returned breakpoints include the endpoints # $breakpoints # [1] 1 503 1000 # # $number_of_segments # [1] 2 # # $segment_kernel_orders_m # [1] 2 4 ##-- plot everything par(mfrow=c(3,1)) tsplot(x, col=4) abline(v=503, col=6, lty=2, lwd=2) mvspec(x[1:502], kernel=bart(2), taper=.5, main='segment 1', col=4, xlim=c(0,.25)) mvspec(x[503:1000], kernel=bart(4), taper=.5, main='segment 2', col=4, xlim=c(0,.25)) ## End(Not run)
Smoothing (triangular) kernel that decreases one unit from the center.
bart(m)bart(m)
m |
non-negative integer specifying the kernel width, which is |
Uses kernel from the stats package to construct a Bartlett (triangular) kernel of width 2m + 1; see help(kernel) for further details.
Returns an object of class tskernel with the coefficients, the kernel dimension, and attribute "Bartlett".
D.S. Stoffer
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
bart(4) # for a list plot(bart(4), ylim=c(.01,.21)) # for a graphbart(4) # for a list plot(bart(4), ylim=c(.01,.21)) # for a graph
Daily returns of three banks, 1. Bank of America [boa], 2. Citibank [citi], and 3. JP Morgan Chase [jpm], from 2005 to 2017.
The format is: Time-Series [1:3243, 1:3] from 2005 to 2017: -0.01378 -0.01157 -0.00155 -0.01084 0.01252 ... with column names "boa" "citi" "jpm" .
Gong & Stoffer (2021). A Note on Efficient Fitting of Stochastic Volatility Models. Journal of Time Series Analysis, 42(2), 186-200.
https://github.com/nickpoison/Stochastic-Volatility-Models
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
tsplot(BCJ, col=2:4)tsplot(BCJ, col=2:4)
Infrasonic signal from a nuclear explosion.
data(beamd)data(beamd)
A data frame with 2048 observations (rows) on 3 numeric variables (columns): sensor1, sensor2, sensor3.
This is a data frame consisting of three columns (that are not time series objects). The data are an infrasonic signal from a nuclear explosion observed at sensors on a triangular array.
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
Monthly live births (adjusted) in thousands for the United States, 1948-1979.
The format is: Time-Series [1:373] from 1948 to 1979: 295 286 300 278 272 268 308 321 313 308 ...
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
Multiple time series of measurements made for 91 days on the three variables, log(white blood count) [WBC], log(platelet) [PLT] and hematocrit [HCT]. Missing data code is NA.
Time-Series [1:91, 1:3] from 1 to 91: 2.33 1.89 2.08 1.82 1.82 ...
..$ : NULL ..$ : chr [1:3] "WBC" "PLT" "HCT"
This data set is used in Chapter 6 for a missing data example.
Jones, R.H. (1984). Fitting multivariate models to unequally spaced data. In Time Series Analysis of Irregularly Observed Data, pp. 158-188. E. Parzen, ed. Lecture Notes in Statistics, 25, New York: Springer-Verlag.
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
# use type='o' when plotting series with missing data tsplot(blood, type='o', pch=19, cex=1.1, col=2:4, gg=TRUE, xlab='day')# use type='o' when plotting series with missing data tsplot(blood, type='o', pch=19, cex=1.1, col=2:4, gg=TRUE, xlab='day')
Nucleotide sequence of the BNRF1 gene of the Epstein-Barr virus (EBV): 1=A, 2=C, 3=G, 4=T. The data are used in Chapter 7.
The format is: Time-Series [1:3954] from 1 to 3954: 1 4 3 3 1 1 3 1 3 1 ...
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
head(bnrf1ebv) head(dna2vector(bnrf1ebv))head(bnrf1ebv) head(dna2vector(bnrf1ebv))
Nucleotide sequence of the BNRF1 gene of the herpesvirus saimiri (HVS): 1=A, 2=C, 3=G, 4=T. The data are used in Chapter 7.
The format is: Time-Series [1:3741] from 1 to 3741: 1 4 3 2 4 4 3 4 4 4 ...
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
head(bnrf1hvs) head(dna2vector(bnrf1hvs))head(bnrf1hvs) head(dna2vector(bnrf1hvs))
Monthly mean carbon dioxide (in ppm) measured at Mauna Loa Observatory, Hawaii.
This is an update to co2 in the datasets package.
The format is: Time-Series [1:781] from 1958 to 2023: 316 317 318 317 316 ...
The carbon dioxide data measured as the mole fraction in dry air, on Mauna Loa constitute the longest record of direct measurements of CO2 in the atmosphere. They were started by C. David Keeling of the Scripps Institution of Oceanography in March of 1958 at a facility of the National Oceanic and Atmospheric Administration. NOAA started its own CO2 measurements in May of 1974, and they have run in parallel with those made by Scripps since then. Data are reported as a dry mole fraction defined as the number of molecules of carbon dioxide divided by the number of molecules of dry air multiplied by one million (ppm).
Due to the eruption of the Mauna Loa Volcano, measurements from Mauna Loa Observatory were suspended as of Nov. 29, 2022. Observations starting in December 2022 are from a site at the Maunakea Observatories, approximately 21 miles north of the Mauna Loa Observatory.
The reason this data file is called cardox is because R has two datasets called CO2 and co2, which doesn't leave many options if you don't want to create potential problems like the dplyr people. Anyway, cardox sounds like the name of a cool character in some SciFi movie.
https://gml.noaa.gov/ccgg/trends/
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
Calculates and plots the sample CCF of two time series.
ccf2(x, y, max.lag = NULL, main = NULL, ylab = "CCF", plot = TRUE, na.action = na.pass, type = c("correlation", "covariance"), ...)ccf2(x, y, max.lag = NULL, main = NULL, ylab = "CCF", plot = TRUE, na.action = na.pass, type = c("correlation", "covariance"), ...)
x, y
|
univariate time series |
max.lag |
maximum lag for which to calculate the CCF. Can be omitted. Unless |
main |
plot title - if NULL, uses x and y names |
ylab |
vertical axis label; default is 'CCF' |
plot |
if TRUE (default) a graphic is produced and the values are returned invisibly. Otherwise, the values are returned. |
na.action |
how to handle missing values; default is |
type |
default is cross-correlation; an option is cross-covariance |
... |
additional arguments passed to |
This will produce a graphic of the sample corr[x(t+lag), y(t)] from -max.lag to max.lag. Also, the (rounded) values of the CCF are returned invisibly unless plot=FALSE. Similar details apply to the cross-covariance.
D.S. Stoffer
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
ccf2(soi, rec, plot=FALSE, max.lag=6) # now you see it ccf2(soi, rec) # now you don't # happy birthday ccf2(soi, rec, col=astsa.col(4, wheel=TRUE, num=6), lwd=4, gg=TRUE)ccf2(soi, rec, plot=FALSE, max.lag=6) # now you see it ccf2(soi, rec) # now you don't # happy birthday ccf2(soi, rec, col=astsa.col(4, wheel=TRUE, num=6), lwd=4, gg=TRUE)
Poultry (chicken), Whole bird spot price, Georgia docks, US cents per pound
The format is: Time-Series [1:180] from August 2001 to July 2016: 65.6 66.5 65.7 64.3 63.2 ...
https://www.indexmundi.com/commodities/
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
Lake Shasta inflow data. This is a data frame.
A data frame with 454 observations (rows) on the following 6 numeric variables (columns): Temp, DewPt, CldCvr, WndSpd, Precip, Inflow.
The data are 454 months of measured values for the climatic variables: air temperature, dew point, cloud cover, wind speed, precipitation, and inflow, at Lake Shasta, California.
Lake Shasta is a man-made reservoir that is situated on ancestral lands of the Shasta Indian Nation. The area around the lake was once a thriving homeland for the Shasta. The construction of the reservoir submerged many of these significant cultural sites, leading to displacement and hardship for the Shasta people. The California Gold Rush drew in outsiders in the late 1840s. For the Shasta, this was a devastating process as thousands of miners who did not respect the Shasta or their homeland, operated along various waterways. Introduction of diseases and fighting against white people, rapidly reduced the number of Shasta. For more information, see https://www.legendsofamerica.com/shasta-indians.
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
tsplot(climhyd, ncolm=2, col=2:7, lwd=2, scale=.9)tsplot(climhyd, ncolm=2, col=2:7, lwd=2, scale=.9)
Average weekly cardiovascular mortality in Los Angeles County; 508 six-day smoothed averages obtained by filtering daily values over the 10 year period 1970-1979.
The format is: Time-Series [1:508] from 1970 to 1980: 97.8 104.6 94.4 98 95.8 ...
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
Median annual cost per gigabyte (GB) of storage.
The format is: Time-Series [1:29] from 1980 to 2008: 213000.00 295000.00 260000.00 175000.00 160000.00 ...
This is a good data set for a first exercise on regression with autocorrelated errors.
The data are retail prices per GB taken from a sample of manufacturers listed at https://mkomo.com/cost-per-gigabyte. From there, the median cost per GB was computed by year.
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
Returns a time series with the trend removed. The trend can be estimated using polynomial regression or using a lowess fit.
detrend(series, order = 1, lowess = FALSE, lowspan = 2/3)detrend(series, order = 1, lowess = FALSE, lowspan = 2/3)
series |
The time series to be detrended. |
order |
Order of the polynomial used to estimate the trend with a linear default (order=1) unless |
lowess |
If TRUE, lowess is used to find the trend. The default is FALSE. |
lowspan |
The smoother span used for lowess. |
The detrended series is returned.
D.S. Stoffer
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
tsplot( cbind(salmon, detrend(salmon)), gg=TRUE, main='Norwegian Salmon USD/KG' )tsplot( cbind(salmon, detrend(salmon)), gg=TRUE, main='Norwegian Salmon USD/KG' )
Daily DJIA values from April 2006 - April 2016
The format is:
xts [1:2518, 1:5] 11279 11343 11347 11337 11283 ...
- attr(*, "class")= chr [1:2] "xts" "zoo"
..$ : chr [1:5] "Open" "High" "Low" "Close" "Volume"
The data were obtained via the TTR package and Yahoo financial data.
Unfortunately, this does not work now. It seems like the R package
quantmod is a good bet and Yahoo still has financial data.
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
# the file is an 'xts' data file # if 'xts' is not installed you can still do this tsplot(djia, ncolm=2, col=2:6) # no dates tsplot(timex(djia), djia, ncolm=2, col=2:6) # dates # differencing (on its own) loses an obs return = diff(log(djia[,'Close'])) tsplot(timex(djia)[-1], return, col=4, gg=TRUE, main='DJIA')# the file is an 'xts' data file # if 'xts' is not installed you can still do this tsplot(djia, ncolm=2, col=2:6) # no dates tsplot(timex(djia), djia, ncolm=2, col=2:6) # dates # differencing (on its own) loses an obs return = diff(log(djia[,'Close'])) tsplot(timex(djia)[-1], return, col=4, gg=TRUE, main='DJIA')
Takes a string (e.g., a DNA sequence) of general form (e.g., FASTA) and converts it to a sequence of indicator vectors for use with the Spectral Envelope (specenv).
dna2vector(data, alphabet = NULL)dna2vector(data, alphabet = NULL)
data |
A single string. |
alphabet |
The particular alphabet being used. The default is |
Takes a string of categories and converts it to a matrix of indicators. The data can then be used by the script specenv, which calculates the Spectral Envelope of the sequence (or subsequence). Many different type of sequences can be used, including FASTA and GenBank, as long as the data is a string of categories.
The indicator vectors (as a matrix) are returned invisibly in case the user forgets to put the results in an object wherein the screen would scroll displaying the entire sequence. In other words, the user should do something like xdata = dna2vector(data) where data is the original sequence.
If the DNA sequence is in a FASTA file, say sequence.fasta, the following code can be used to read the data into the session, create the indicator sequence and save it as a compressed R data file:
fileName <- 'sequence.fasta' # name of FASTA file
data <- readChar(fileName, file.info(fileName)$size) # input the sequence
myseq <- dna2vector(data) # convert it to indicators
##== to compress and save the data ==##
save(myseq, file='myseq.rda')
##== and then load it when needed ==##
load('myseq.rda')
matrix of indicator vectors; returned invisibly
D.S. Stoffer
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
# Epstein-Barr virus (entire sequence included in astsa) substr(EBV, start=1, stop=25) xdata = dna2vector(EBV) head(xdata) # part of EBV with 1, 2, 3, 4 for "A", "C", "G", "T" xdata = dna2vector(bnrf1ebv) head(xdata) # raw GenBank sequence data <- c("1 agaattcgtc ttgctctatt cacccttact tttcttcttg cccgttctct ttcttagtat 61 gaatccagta tgcctgcctg taattgttgc gccctacctc ttttggctgg cggctattgc") xdata = dna2vector(data, alphabet=c('a', 'c', 'g', 't')) head(xdata) # raw FASTA sequence data <- c("AGAATTCGTCTTGCTCTATTCACCCTTACTTTTCTTCTTGCCCGTTCTCTTTCTTAGTATGAATCCAGTA TGCCTGCCTGTAATTGTTGCGCCCTACCTCTTTTGGCTGGCGGCTATTGCCGCCTCGTGTTTCACGGCCT") xdata = dna2vector(data) head(xdata)# Epstein-Barr virus (entire sequence included in astsa) substr(EBV, start=1, stop=25) xdata = dna2vector(EBV) head(xdata) # part of EBV with 1, 2, 3, 4 for "A", "C", "G", "T" xdata = dna2vector(bnrf1ebv) head(xdata) # raw GenBank sequence data <- c("1 agaattcgtc ttgctctatt cacccttact tttcttcttg cccgttctct ttcttagtat 61 gaatccagta tgcctgcctg taattgttgc gccctacctc ttttggctgg cggctattgc") xdata = dna2vector(data, alphabet=c('a', 'c', 'g', 't')) head(xdata) # raw FASTA sequence data <- c("AGAATTCGTCTTGCTCTATTCACCCTTACTTTTCTTCTTGCCCGTTCTCTTTCTTAGTATGAATCCAGTA TGCCTGCCTGTAATTGTTGCGCCCTACCTCTTTTGGCTGGCGGCTATTGCCGCCTCGTGTTTCACGGCCT") xdata = dna2vector(data) head(xdata)
EBV nucleotide sequence - 172281 bp as a single string
The format is: chr "AGAATTCGTCTT ..."
EBV is not useful on its own, but using 'dna2vector', different regions can be explored. For example, ebv = dna2vector(EBV)
https://www.ncbi.nlm.nih.gov/nuccore/V01555.2
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
substr(EBV, start=1, stop=25) head(dna2vector(EBV))substr(EBV, start=1, stop=25) head(dna2vector(EBV))
Multiple time series of quarterly U.S. unemployment, GNP, consumption, and government and private investment, from 1948-III to 1988-II.
Multiple time series with 161 observations (rows) on the following 5 numeric variables (columns): unemp, gnp, consum, govinv, prinv.
unemp is in percentage (of the labor force), and the others are in 1982 Billions USD.
Young, P.C. and Pedregal, D.J. (1999). Macro-economic relativity: government spending, private investment and unemployment in the USA 1948-1998. Structural Change and Economic Dynamics, 10, 359-380.
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
tsplot(econ5, ncolm=2, col=2:6, lwd=2, title=colnames(econ5), ylab=c('%', rep('Billions-USD', 4)))tsplot(econ5, ncolm=2, col=2:6, lwd=2, title=colnames(econ5), ylab=c('%', rep('Billions-USD', 4)))
Estimation of the parameters in general linear state space models via the EM algorithm.
Missing data may be entered as NA or as zero (0), however, use NAs if zero (0) can be an
observation. Inputs in both the state and observation equations are allowed. This script replaces EM0 and EM1.
EM(y, A, mu0, Sigma0, Phi, Q, R, Ups = NULL, Gam = NULL, input = NULL, max.iter = 100, tol = 1e-04)EM(y, A, mu0, Sigma0, Phi, Q, R, Ups = NULL, Gam = NULL, input = NULL, max.iter = 100, tol = 1e-04)
y |
data matrix (n |
A |
measurement matrices; can be constant or an array with dimension |
mu0 |
initial state mean vector (p |
Sigma0 |
initial state covariance matrix (p |
Phi |
state transition matrix (p |
Q |
state error matrix (p |
R |
observation error matrix (q |
Ups |
state input matrix (p |
Gam |
observation input matrix (q |
input |
NULL (default) if not needed or a
matrix (n |
max.iter |
maximum number of iterations |
tol |
relative tolerance for determining convergence |
This script replaces EM0 and EM1 by combining all cases and allowing inputs in the state
and observation equations. It uses version 1 of the new Ksmooth script (hence correlated errors
is not allowed).
The states are p-dimensional, the data are q-dimensional, and
the inputs are r-dimensional for . The initial state is .
The general model is
where . The observation noise covariance matrix is assumed to be diagonal and it is forced
to diagonal otherwise.
The measurement matrices can be constant or time varying. If time varying, they should be entered as an array of dimension dim = c(q,p,n). Otherwise, just enter the constant value making sure it has the appropriate dimension.
Phi |
Estimate of Phi |
Q |
Estimate of Q |
R |
Estimate of R |
Ups |
Estimate of Upsilon (NULL if not used) |
Gam |
Estimate of Gamma (NULL if not used) |
mu0 |
Estimate of initial state mean |
Sigma0 |
Estimate of initial state covariance matrix |
like |
-log likelihood at each iteration |
niter |
number of iterations to convergence |
cvg |
relative tolerance at convergence |
The script does not allow for constrained estimation directly, however, constrained estimation is possible with some extra manipulations. There is an example of constrained estimation using EM at FUN WITH ASTSA, where the fun never stops.
D.S. Stoffer
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
y = ar1miss # an 'astsa' data set with missing values A = 1; Phi = .1; Ups = 1 Q = 0.1; R = 0.1; Gam=1 mu0 = 0; Sigma0 = 1 input = rep(1, length(y)) ( em = EM(y, A, mu0, Sigma0, Phi, Q, R, Ups, Gam, input) ) # run Kalman smoother at the final estimates ks = Ksmooth(y, A=1, em$mu0, em$Sigma0, em$Phi, sQ=sqrt(em$Q), sR=sqrt(em$R), Ups=em$Ups, Gam=em$Gam, input=input) # admire your work tsplot(cbind(y, drop(ks$Xs)), type='o', pch=c(19,NA), col=2*2:3, lwd=1:2, gg=TRUE, spag=TRUE, addLegend=TRUE, legend=c('data', 'smooth')) miss = cbind(which(is.na(y)), min(y, na.rm=TRUE)-.2) # show yourself points(miss, pch=18)y = ar1miss # an 'astsa' data set with missing values A = 1; Phi = .1; Ups = 1 Q = 0.1; R = 0.1; Gam=1 mu0 = 0; Sigma0 = 1 input = rep(1, length(y)) ( em = EM(y, A, mu0, Sigma0, Phi, Q, R, Ups, Gam, input) ) # run Kalman smoother at the final estimates ks = Ksmooth(y, A=1, em$mu0, em$Sigma0, em$Phi, sQ=sqrt(em$Q), sR=sqrt(em$R), Ups=em$Ups, Gam=em$Gam, input=input) # admire your work tsplot(cbind(y, drop(ks$Xs)), type='o', pch=c(19,NA), col=2*2:3, lwd=1:2, gg=TRUE, spag=TRUE, addLegend=TRUE, legend=c('data', 'smooth')) miss = cbind(which(is.na(y)), min(y, na.rm=TRUE)-.2) # show yourself points(miss, pch=18)
Southern Oscillation Index (SOI), 1/1951 to 10/2022; anomalies are departures from the 1981-2010 base period.
The format is: Time-Series [1:862] from 1951 to 2022: 2.0 1.1 -0.3 -0.8 -1.1 -0.7 -1.5 -0.3 -0.7 -0.7 ...
The is a recurring climate pattern involving changes in the temperature of waters in the central and eastern tropical Pacific Ocean. This data set is an update to soi.
https://www.ncei.noaa.gov/access/monitoring/enso/soi
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
# ENSO is a standardized index based on the sea level pressure differences between # Tahiti and Darwin, Australia. MEI is a similar index based on multiple factors. # As opposed to ENSO (and SOI), positive values of MEI correspond to warmer temperatures. tsplot(cbind(-ENSO, MEI), col=astsa.col(2*2:1, .6), addLegend=TRUE, spag=TRUE, lwd=1:2) tspairs(ts.intersect(-ENSO, MEI), location='top')# ENSO is a standardized index based on the sea level pressure differences between # Tahiti and Darwin, Australia. MEI is a similar index based on multiple factors. # As opposed to ENSO (and SOI), positive values of MEI correspond to warmer temperatures. tsplot(cbind(-ENSO, MEI), col=astsa.col(2*2:1, .6), addLegend=TRUE, spag=TRUE, lwd=1:2) tspairs(ts.intersect(-ENSO, MEI), location='top')
Seismic trace of an earthquake [two phases or arrivals along the surface, the primary wave () and the shear wave ()] recorded at a seismic station.
The format is: Time-Series [1:2048] from 1 to 2048: 0.01749 0.01139 0.01512 0.01477 0.00651 ...
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
Series of annual counts of major earthquakes (magnitude 7 and above) in the world between 1900 and 2006.
The format is: Time-Series [1:107] from 1900 to 2006: 13 14 8 10 16 26 ...
Zucchini and MacDonald (2009). Hidden Markov Models for Time Series: An Introduction using R. CRC Press.
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
This is a data frame of the earthquake and explosion seismic series used throughout the text.
A data frame with 2048 observations (rows) on 17 variables (columns). Each column is a numeric vector.
The matrix has 17 columns, the first eight are earthquakes, the second eight are explosions, and the last column is the Novaya Zemlya event of unknown origin.
The column names are: EQ1, EQ2,...,EQ8; EX1, EX2,...,EX8; NZ. The first 1024 observations correspond to the P wave, the second 1024 observations correspond to the S wave.
All events in the data set were on or near land and were distributed uniformly over Scandinavia so as to minimize the possibility that discriminators might be keying on location or land-sea differences. The events are earthquakes ranging in magnitude from 2.74 to 4.40 and explosions in the range 2.13 to 2.19. Also added is an event of uncertain origin that was located in the Novaya Zemlya region of Russia. All events except the Russian event occurred in the Scandinavian peninsula and were recorded by seismic arrays located in Norway by Norwegian and Arctic experimental seismic stations (NORESS, ARCESS) and in Finland by Finnish experimental seismic stations (FINESS).
| No. | Type | Date | Array | Magnitude | Latitude | Longitude |
| 1 | EQ | 6/16/92 | FINESS | 3.22 | 65.5 | 22.9 |
| 2 | EQ | 8/24/91 | ARCESS | 3.18 | 65.7 | 32.1 |
| 3 | EQ | 9/23/91 | NORESS | 3.15 | 64.5 | 21.3 |
| 4 | EQ | 7/4/92 | FINESS | 3.60 | 67.8 | 15.1 |
| 5 | EQ | 2/19/92 | ARCESS | 3.26 | 59.2 | 10.9 |
| 6 | EQ | 4/13/92 | NORESS | 4.40 | 51.4 | 6.1 |
| 7 | EQ | 4/14/92 | NORESS | 3.38 | 59.5 | 5.9 |
| 8 | EQ | 5/18/92 | NORESS | 2.74 | 66.9 | 13.7 |
| 9 | EX | 3/23/91 | ARCESS | 2.85 | 69.2 | 34.3 |
| 10 | EX | 4/13/91 | FINESS | 2.60 | 61.8 | 30.7 |
| 11 | EX | 4/26/91 | ARCESS | 2.95 | 67.6 | 33.9 |
| 12 | EX | 8/3/91 | ARCESS | 2.13 | 67.6 | 30.6 |
| 13 | EX | 9/5/91 | ARCESS | 2.32 | 67.1 | 21.0 |
| 14 | EX | 12/10/91 | FINESS | 2.59 | 59.5 | 24.1 |
| 15 | EX | 12/29/91 | ARCESS | 2.96 | 69.4 | 30.8 |
| 16 | EX | 3/25/92 | NORESS | 2.94 | 64.7 | 30.8 |
| 17 | NZ | 12/31/92 | NORESS | 2.50 | 73.6 | 55.2 |
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
# view all series # first 2 rows EQs - next 2 rows EXs # 5th row NZ event tsplot(eqexp, ncol=4, col=c(rep(6,8),rep(4,8),2), scale=.75) ## Not run: # for a nice html map, use the 'leaflet' package library(leaflet) # install if you don't have it lat = c( 65.5,65.7,64.5,67.8,59.2,51.4,59.5,66.9, 69.2,61.8,67.6,67.6,67.1,59.5,69.4,64.7, 73.6) long = c( 22.9,32.1,21.3,15.1,10.9,6.1,5.9,13.7, 34.3,30.7,33.9,30.6,21.0,24.1,30.8,30.8, 55.2) event = c( "EQ1","EQ2","EQ3","EQ4","EQ5","EQ6","EQ7","EQ8", "EX1","EX2","EX3","EX4","EX5","EX6","EX7","EX8", "NZ") eventmap = data.frame( longitude = long, latitude = lat, event = event ) leaflet(eventmap) %>% addTiles() %>% addMarkers(~longitude, ~latitude, label = ~event, labelOptions = labelOptions(noHide = TRUE)) ## End(Not run)# view all series # first 2 rows EQs - next 2 rows EXs # 5th row NZ event tsplot(eqexp, ncol=4, col=c(rep(6,8),rep(4,8),2), scale=.75) ## Not run: # for a nice html map, use the 'leaflet' package library(leaflet) # install if you don't have it lat = c( 65.5,65.7,64.5,67.8,59.2,51.4,59.5,66.9, 69.2,61.8,67.6,67.6,67.1,59.5,69.4,64.7, 73.6) long = c( 22.9,32.1,21.3,15.1,10.9,6.1,5.9,13.7, 34.3,30.7,33.9,30.6,21.0,24.1,30.8,30.8, 55.2) event = c( "EQ1","EQ2","EQ3","EQ4","EQ5","EQ6","EQ7","EQ8", "EX1","EX2","EX3","EX4","EX5","EX6","EX7","EX8", "NZ") eventmap = data.frame( longitude = long, latitude = lat, event = event ) leaflet(eventmap) %>% addTiles() %>% addMarkers(~longitude, ~latitude, label = ~event, labelOptions = labelOptions(noHide = TRUE)) ## End(Not run)
Estimates the ESS of a given vector of samples.
ESS(trace, tol = 1e-08, BIC = TRUE, digits=2)ESS(trace, tol = 1e-08, BIC = TRUE, digits=2)
trace |
vector of sampled values from an MCMC run (univariate only) |
tol |
ESS is returned as zero if the estimated spectrum at frequency zero is less than this value |
BIC |
if TRUE (default), |
digits |
integer indicating the approximate number of decimal places to be used |
Uses spec.ic to estimate the spectrum of the input at frequency zero (spec0). Then, ESS is estimated as ESS = length(trace)*var(trace)/spec0. See Examples for multivariate case.
ESS is discussed in detail in Example 6.31 of Time Series Analysis and Its Applications: With R Examples (5th ed, 2025).
Returns the estimated ESS of the input.
D.S. Stoffer
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
# How autocorrelation affects ESS # get a few Markov chains x = matrix(NA, 500, 3) # sample size is 500 phi = c(0,.3,.9) # no, low, high for (i in 1:3) x[,i] = sarima.sim(ar=phi[i]) apply(x, 2, ESS, digits=0)# How autocorrelation affects ESS # get a few Markov chains x = matrix(NA, 500, 3) # sample size is 500 phi = c(0,.3,.9) # no, low, high for (i in 1:3) x[,i] = sarima.sim(ar=phi[i]) apply(x, 2, ESS, digits=0)
Seismic trace of an explosion [two phases or arrivals along the surface, the primary wave () and the shear wave ()] recorded at a seismic station.
The format is: Time-Series [1:2048] from 1 to 2048: -0.001837 -0.000554 -0.002284 -0.000303 -0.000721 ...
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
Computes the basic false discovery rate given a vector of p-values and returns the index of the maximal p-value satisfying the FDR condition.
FDR(pvals, qlevel = 0.05)FDR(pvals, qlevel = 0.05)
pvals |
a vector of pvals on which to conduct the multiple testing |
qlevel |
the proportion of false positives desired |
fdr.id |
NULL if no significant tests, or the index of the maximal p-value satisfying the FDR condition. |
This is used primarily in Chapter 7.
Built off of https://www.stat.berkeley.edu/~paciorek/code/fdr/fdr.R.
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
FFBS algorithm for state space models
ffbs(y, A, mu0, Sigma0, Phi, sQ, sR, Ups = NULL, Gam = NULL, input = NULL)ffbs(y, A, mu0, Sigma0, Phi, sQ, sR, Ups = NULL, Gam = NULL, input = NULL)
y |
Data matrix, vector or time series. |
A |
Observation matrix. Can be constant or an array with
|
mu0 |
Initial state mean. |
Sigma0 |
Initial state covariance matrix. |
Phi |
State transition matrix. |
sQ |
State error covariance matrix is |
sR |
Observation error covariance matrix is |
Ups |
State input matrix. |
Gam |
Observation input matrix. |
input |
matrix or vector of inputs having the same row dimension as y. |
For a linear state space model,
the FFBS algorithm provides a way to sample a state sequence
from the posterior
with parameters and data .
The general model is
where . Consequently the state noise covariance matrix is
and the observation noise covariance matrix is
and do not have to be square as long as everything is
conformable.
is p-dimensional, is q-dimensional, and is r-dimensional.
Note that has to be p-dimensional, but does not, and
has to be q-dimensional, but does not.
Xs |
An array of sampled states |
X0n |
The sampled initial state (because R is 1-based) |
The script uses Kfilter. If is constant wrt time, it is not necessary to
input an array; see the example. The example below is just one pass of the algorithm; see the example
at FUN WITH ASTSA for the real fun.
D.S. Stoffer
Chapter 6 of the Shumway and Stoffer Springer text.
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
## Not run: ## -- this is just one pass --## # generate some data set.seed(1) sQ = 1; sR = 3; n = 100 mu0 = 0; Sigma0 = 10; x0 = rnorm(1,mu0,Sigma0) w = rnorm(n); v = rnorm(n) x = c(x0 + sQ*w[1]); y = c(x[1] + sR*v[1]) # initialize for (t in 2:n){ x[t] = x[t-1] + sQ*w[t] y[t] = x[t] + sR*v[t] } ## run one pass of FFBS, plot data, states and sampled states run = ffbs(y, A=1, mu0=0, Sigma0=10, Phi=1, sQ=1, sR=3) tsplot(cbind(y,run$Xs), spaghetti=TRUE, type='o', col=c(8,4), pch=c(1,NA)) legend('topleft', legend=c("y(t)","xs(t)"), lty=1, col=c(8,4), bty="n", pch=c(1,NA)) ## End(Not run)## Not run: ## -- this is just one pass --## # generate some data set.seed(1) sQ = 1; sR = 3; n = 100 mu0 = 0; Sigma0 = 10; x0 = rnorm(1,mu0,Sigma0) w = rnorm(n); v = rnorm(n) x = c(x0 + sQ*w[1]); y = c(x[1] + sR*v[1]) # initialize for (t in 2:n){ x[t] = x[t-1] + sQ*w[t] y[t] = x[t] + sR*v[t] } ## run one pass of FFBS, plot data, states and sampled states run = ffbs(y, A=1, mu0=0, Sigma0=10, Phi=1, sQ=1, sR=3) tsplot(cbind(y,run$Xs), spaghetti=TRUE, type='o', col=c(8,4), pch=c(1,NA)) legend('topleft', legend=c("y(t)","xs(t)"), lty=1, col=c(8,4), bty="n", pch=c(1,NA)) ## End(Not run)
Monthly pneumonia and influenza deaths per 10,000 people in the United States for 11 years, 1968 to 1978.
data(flu)data(flu)
The format is: Time-Series [1:132] from 1968 to 1979: 0.811 0.446 0.342 0.277 0.248 ...
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
Data (as a vector list) from an fMRI experiment in pain, listed by location and stimulus. The data are BOLD signals when a stimulus was applied for 32 seconds and then stopped for 32 seconds. The signal period is 64 seconds and the sampling rate was one observation every 2 seconds for 256 seconds (). The number of subjects under each condition varies.
The LOCATIONS of the brain where the signal was measured were [1] Cortex 1: Primary Somatosensory, Contralateral, [2] Cortex 2: Primary Somatosensory, Ipsilateral, [3] Cortex 3: Secondary Somatosensory, Contralateral, [4] Cortex 4: Secondary Somatosensory, Ipsilateral, [5] Caudate, [6] Thalamus 1: Contralateral, [7] Thalamus 2: Ipsilateral, [8] Cerebellum 1: Contralateral and [9] Cerebellum 2: Ipsilateral.
The TREATMENTS or stimuli (and number of subjects in each condition) are [1] Awake-Brush (5 subjects), [2] Awake-Heat (4 subjects), [3] Awake-Shock (5 subjects), [4] Low-Brush (3 subjects), [5] Low-Heat (5 subjects), and [6] Low-Shock (4 subjects). Issue the command summary(fmri) for further details. In particular, awake (Awake) or mildly anesthetized (Low) subjects were subjected levels of periodic brushing (Brush), application of heat (Heat), and mild shock (Shock) effects.
As an example, fmri$L1T6 (Location 1, Treatment 6) will show the data for the four subjects receiving the Low-Shock treatment at the Cortex 1 location; note that fmri[[6]] will display the same data.
Joseph F. Antognini, Michael H. Buonocore, Elizabeth A. Disbrow, Earl Carstens,
Isoflurane anesthesia blunts cerebral responses to noxious and innocuous stimuli: a fMRI study,
Life Sciences, Volume 61, Issue 24, 1997, Pages PL349-PL354, ISSN 0024-3205,
https://doi.org/10.1016/S0024-3205(97)00960-0.
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
A data frame that consists of average fMRI BOLD signals at eight locations.
data(fmri1)data(fmri1)
The format is: mts [1:128, 1:9]
Multiple time series consisting of fMRI BOLD signals at eight locations (in columns 2-9, column 1 is time period), when a stimulus was applied for 32 seconds and then stopped for 32 seconds. The signal period is 64 seconds and the sampling rate was one observation every 2 seconds for 256 seconds (). The columns are labeled: "time" "cort1" "cort2" "cort3" "cort4" "thal1" "thal2" "cere1" "cere2".
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
tsplot(fmri1[,2:9], ncolm=4, gg=TRUE, col=c(rep(4,4),rep(3,2),rep(6,2)))tsplot(fmri1[,2:9], ncolm=4, gg=TRUE, col=c(rep(4,4),rep(3,2),rep(6,2)))
New York Harbor conventional regular gasoline weekly spot price FOB (in cents per gallon) from 2000 to mid-2010.
The format is: Time-Series [1:545] from 2000 to 2010: 70.6 71 68.5 65.1 67.9 ...
Pairs with series oil
Data were obtained from: https://www.eia.gov/dnav/pet/pet_pri_spt_s1_w.htm
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
tsplot(cbind(gas,oil), spag=TRUE, col=2*1:2, addLegend=TRUE)tsplot(cbind(gas,oil), spag=TRUE, col=2*1:2, addLegend=TRUE)
Seasonally adjusted quarterly U.S. GDP from 1947(1) to 2018(3).
The format is: Time-Series [1:287] from 1947 to 2018: 2033 2028 2023 2055 2086 ...
https://tradingeconomics.com/united-states/gdp
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
Seasonally adjusted quarterly U.S. GDP from 1947(1) to 2023(1).
The format is: Time-Series [1:305] from 1947 to 2023: 243.164 245.968 249.585 259.745 ...
https://fred.stlouisfed.org/series/GDP
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
Seasonally adjusted quarterly U.S. GNP from 1947(1) to 2002(3).
The format is: Time-Series [1:223] from 1947 to 2002: 1489 1497 1500 1524 1547 ...
https://fred.stlouisfed.org/series/GNP
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
Seasonally adjusted quarterly U.S. GNP from 1947(1) to 2003(1).
The format is: Time-Series [1:305] from 1947 to 2023: 244.142 247.063 250.716 260.981 ...
https://fred.stlouisfed.org/series/GNP
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
Adds a grid to an existing plot with major and minor ticks. Works like R graphics grid() but the grid lines are solid and gray and minor ticks are produced by default.
Grid(nx = NULL, ny = nx, col = gray(0.9), lty = 1, lwd = par("lwd"), equilogs = TRUE, minor = TRUE, nxm = 2, nym = 2, tick.ratio = 0.5, xm.grid = TRUE, ym.grid = TRUE, ...)Grid(nx = NULL, ny = nx, col = gray(0.9), lty = 1, lwd = par("lwd"), equilogs = TRUE, minor = TRUE, nxm = 2, nym = 2, tick.ratio = 0.5, xm.grid = TRUE, ym.grid = TRUE, ...)
nx, ny
|
number of cells of the grid in x and y direction. When NULL, as per default, the grid aligns with the tick marks on the corresponding default axis (i.e., tickmarks as computed by axTicks). When NA, no grid lines are drawn in the corresponding direction. |
col |
color of the grid lines. |
lty |
line type of the grid lines. |
lwd |
line width of the grid lines. |
equilogs |
logical, only used when log coordinates and alignment with the axis tick marks are active. Setting equilogs = FALSE in that case gives non equidistant tick aligned grid lines. |
minor |
logical with TRUE (default) adding minor ticks. |
nxm, nym
|
number of intervals in which to divide the area between major tick marks on the x-axis (y-axis). If minor=TRUE, should be > 1 or no minor ticks will be drawn. |
tick.ratio |
ratio of lengths of minor tick marks to major tick marks. The length of major tick marks is retrieved from par("tck"). |
xm.grid, ym.grid
|
if TRUE (default), adds grid lines at minor x-axis, y-axis ticks. |
... |
other graphical parameters; |
D.S. Stoffer
The code for grid() in R 'graphics' and minor.tick() from the 'Hmisc' package were combined and then washed, polished, and coated with a subtle metallic finish. The grid now sparkles in the sunlight.
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
Annual temperature anomalies (in degress centigrade) averaged over the Earth's land and ocean area from 1850 to 2023. Anomalies are with respect to the 1991-2020 average.
The format is: Time-Series [1:174] from 1850 to 2023: -0.24 -0.25 -0.27 -0.15 -0.05 -0.16 -0.29 -0.32 -0.19 -0.04 ...
https://www.ncei.noaa.gov/access/monitoring/climate-at-a-glance/global/time-series/
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
Annual temperature anomalies (in degress centigrade) averaged over the Earth's land area from 1850 to 2023. Anomalies are with respect to the 1991-2020 average.
The format is: Time-Series [1:174] from 1850 to 2023: -0.50 -0.60 -0.50 -0.50 -0.20 -0.50 -0.80 -0.40 -0.40 -0.10 ...
https://www.ncei.noaa.gov/access/monitoring/climate-at-a-glance/global/time-series/
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
Annual sea surface temperature anomalies averaged over the part of the ocean that is free of ice at all times (open ocean) from 1850 to 2023. Anomalies are with respect to the 1991-2020 average.
The format is: Time-Series [1:174] from 1850 to 2023: -0.12 -0.08 -0.14 0.04 0.04 0.00 -0.05 -0.27 -0.09 0.01 ...
https://www.ncei.noaa.gov/access/monitoring/climate-at-a-glance/global/time-series/
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
Monthly global average surface temperatures by year. The temperature of the air measured 2 meters above the ground, encompassing land, sea, and in-land water surfaces.
A data frame with 12 monthly observations (as rows) for the years 1975-2023 (as columns in reverse order).
Temperature of air at 2m above the surface of land, sea or in-land waters. 2m temperature is calculated by interpolating between the lowest model level and the Earth's surface, taking account of the atmospheric conditions. Technical details at https://cds.climate.copernicus.eu/datasets/reanalysis-era5-pressure-levels-monthly-means?tab=overview.
https://ourworldindata.org/grapher/monthly-average-surface-temperatures-by-year
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
# functional data plot showing global warming tsplot(gtemp.month, spaghetti=TRUE, col=rainbow(49, start=.2, v=.8, rev=TRUE), ylab='\u00b0C', xlab='Month', xaxt='n', main='Mean Monthly Global Temperature', lwd=c(3,rep(1,47),3)) axis(1, labels=Months, at=1:12) text(10, 13, '1975') text(10.3, 15.5, '2023')# functional data plot showing global warming tsplot(gtemp.month, spaghetti=TRUE, col=rainbow(49, start=.2, v=.8, rev=TRUE), ylab='\u00b0C', xlab='Month', xaxt='n', main='Mean Monthly Global Temperature', lwd=c(3,rep(1,47),3)) axis(1, labels=Months, at=1:12) text(10, 13, '1975') text(10.3, 15.5, '2023')
This is one of the classic studies of predator-prey interactions, the 90-year data set is the number, in thousands, of snowshoe hare pelts purchased by the Hudson's Bay Company (HBC) of Canada. While this is an indirect measure of predation, the assumption is that there is a direct relationship between the number of pelts collected and the number of hare and lynx in the wild.
If you are interested in the brutal story of HBC, see the video https://www.nfb.ca/film/other_side_of_the_ledger or read the article https://canadiangeographic.ca/articles/the-untold-story-of-the-hudsons-bay-company.
The format is: Time-Series [1:91] from 1845 to 1935: 19.6 19.6 19.6 12 28 ...
This data set pairs with Lynx.
The data are in units of one thousand.
From Odum's "Fundamentals of Ecology", p. 191.
Data listed at:
http://people.whitman.edu/~hundledr/courses/M250F03/M250.html
scroll down to: Chapter 6, Difference Equations.
NB: For some reason, there is not a secure and encrypted version of the site above.
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
HCT: Measurements made for 91 days on the three variables, log(white blood count) [WBC], log(platelet) [PLT] and hematocrit [HCT]. Missing data code is 0 (zero).
The format is: Time-Series [1:91] from 1 to 91: 30 30 28.5 34.5 34 32 30.5 31 33 34 ...
See Examples 6.1 and 6.9 for more details.
Jones, R.H. (1984). Fitting multivariate models to unequally spaced data. In Time Series Analysis of Irregularly Observed Data, pp. 158-188. E. Parzen, ed. Lecture Notes in Statistics, 25, New York: Springer-Verlag.
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
Quarterly Hawaiian hotel occupancy rate (percent of rooms occupied) from 1982-I to 2015-IV
The format is: Time-Series [1:136] from 1982 to 2015: 79 65.9 70.9 66.7 ...
https://dbedt.hawaii.gov/economic/qser/tourism/
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
tsplot(hor, type='c') # plot data and text(hor, labels=1:4, col=c(1,4,2,6), cex=.9) # add quarter labelstsplot(hor, type='c') # plot data and text(hor, labels=1:4, col=c(1,4,2,6), cex=.9) # add quarter labels
Johnson and Johnson quarterly earnings per share, 84 quarters (21 years) measured from the first quarter of 1960 to the last quarter of 1980.
The format is: Time-Series [1:84] from 1960 to 1981: 0.71 0.63 0.85 0.44 0.61 0.69 0.92 0.55 0.72 0.77 ...
The data were provided (personal communication) by Professor Paul Griffin, https://gsm.ucdavis.edu/profile/paul-griffin, of the Graduate School of Management, University of California, Davis. This data set is also included with the R distribution as JohnsonJohnson.
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
Returns both the predicted and filtered values for various linear state space models; it also evaluates the likelihood at the given parameter values.
Kfilter(y, A, mu0, Sigma0, Phi, sQ, sR, Ups = NULL, Gam = NULL, input = NULL, S = NULL, version = 1)Kfilter(y, A, mu0, Sigma0, Phi, sQ, sR, Ups = NULL, Gam = NULL, input = NULL, S = NULL, version = 1)
y |
data matrix (n |
A |
can be constant or an array with dimension |
mu0 |
initial state mean vector (p |
Sigma0 |
initial state covariance matrix (p |
Phi |
state transition matrix (p |
sQ |
state error pre-matrix (see details) |
sR |
observation error pre-matrix (see details) |
Ups |
state input matrix (p |
Gam |
observation input matrix (q |
input |
NULL (default) if not needed or a
matrix (n |
S |
covariance matrix between the (not premultiplied) state and observation errors; not necessary to specify if not needed and only used if version=2. See details for more information. |
version |
either 1 (default) or 2; version 2 allows for correlated errors |
This script replaces Kfilter0, Kfilter1, and Kfilter2 by combining all
cases. The major difference is how to specify the covariance matrices; in particular,
sQ = t(cQ) and sR = t(cR) where cQ and cR were used in Kfilter0-1-2 scripts.
The states are p-dimensional, the data are q-dimensional, and
the inputs are r-dimensional for . The initial state is .
The measurement matrices can be constant or time varying. If time varying, they should be entered as an array of dimension dim = c(q,p,n). Otherwise, just enter the constant value making sure it has the appropriate dimension.
Version 1 (default): The general model is
where . Consequently the state noise covariance matrix is
and the observation noise covariance matrix is
and do not have to be square as long as everything is
conformable. Notice the specification of the state and observation covariances has changed from the original scripts.
NOTE: If it is easier to model in terms of and , simply input the square root matrices
sQ = Q %^% .5 and sR = R %^% .5.
Version 2 (correlated errors): The general model is
where , and NOT .
NOTE: If it is easier to model in terms of and , simply input the square root matrices
sQ = Q %^% .5 and sR = R %^% .5.
Note that in either version, has to be p-dimensional, but does not, and
has to be q-dimensional, but does not.
Time varying values are returned as arrays.
Xp |
one-step-ahead prediction of the state |
Pp |
mean square prediction error |
Xf |
filter value of the state |
Pf |
mean square filter error |
like |
the negative of the log likelihood |
innov |
innovation series |
sig |
innovation covariances |
Kn |
last value of the gain, needed for smoothing |
If it is easier to model in terms of and , simply input the square root matrices sQ = Q%^%.5 and sR = R%^%.5.
D.S. Stoffer
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
# generate some data set.seed(1) sQ = 1; sR = 3; n = 100 mu0 = 0; Sigma0 = 10; x0 = rnorm(1,mu0,Sigma0) w = rnorm(n); v = rnorm(n) x = c(x0 + sQ*w[1]); y = c(x[1] + sR*v[1]) # initialize for (t in 2:n){ x[t] = x[t-1] + sQ*w[t] y[t] = x[t] + sR*v[t] } # run and plot the filter run = Kfilter(y, A=1, mu0, Sigma0, Phi=1, sQ, sR) tsplot(cbind(x, y, Xf=run$Xf), spaghetti=TRUE, type='o', col=c(3,4,6), pch=c(NA,1,NA), addLegend=TRUE, location='topleft', lwd=c(2,1,2))# generate some data set.seed(1) sQ = 1; sR = 3; n = 100 mu0 = 0; Sigma0 = 10; x0 = rnorm(1,mu0,Sigma0) w = rnorm(n); v = rnorm(n) x = c(x0 + sQ*w[1]); y = c(x[1] + sR*v[1]) # initialize for (t in 2:n){ x[t] = x[t-1] + sQ*w[t] y[t] = x[t] + sR*v[t] } # run and plot the filter run = Kfilter(y, A=1, mu0, Sigma0, Phi=1, sQ, sR) tsplot(cbind(x, y, Xf=run$Xf), spaghetti=TRUE, type='o', col=c(3,4,6), pch=c(NA,1,NA), addLegend=TRUE, location='topleft', lwd=c(2,1,2))
Returns the smoother values for various linear state space models. The predicted and filtered values and the likelihood at the given parameter values are also returned (via Kfilter).
Ksmooth(y, A, mu0, Sigma0, Phi, sQ, sR, Ups = NULL, Gam = NULL, input = NULL, S = NULL, version = 1)Ksmooth(y, A, mu0, Sigma0, Phi, sQ, sR, Ups = NULL, Gam = NULL, input = NULL, S = NULL, version = 1)
y |
data matrix (n |
A |
can be constant or an array with dimension |
mu0 |
initial state mean vector (p |
Sigma0 |
initial state covariance matrix (p |
Phi |
state transition matrix (p |
sQ |
state error pre-matrix (see details) |
sR |
observation error pre-matrix (see details) |
Ups |
state input matrix (p |
Gam |
observation input matrix (q |
input |
NULL (default) if not needed or a
matrix (n |
S |
covariance matrix between state and observation errors; not necessary to specify if not needed and only used if version=2; see details |
version |
either 1 (default) or 2; version 2 allows for correlated errors |
The states are p-dimensional, the data are q-dimensional, and
the inputs are r-dimensional for . The initial state is .
The measurement matrices can be constant or time varying. If time varying, they should be entered as an array of dimension dim = c(q,p,n). Otherwise, just enter the constant value making sure it has the appropriate dimension.
Version 1 (default): The general model is
where . Consequently the state noise covariance matrix is
and the observation noise covariance matrix is
and do not have to be square as long as everything is
conformable. Notice the specification of the state and observation covariances has changed from the original scripts.
NOTE: If it is easier to model in terms of and , simply input the square root matrices
sQ = Q %^% .5 and sR = R %^% .5.
Version 2 (correlated errors): The general model is
where , and NOT .
NOTE: If it is easier to model in terms of and , simply input the square root matrices
sQ = Q %^% .5 and sR = R %^% .5.
Note that in either version, has to be p-dimensional, but does not, and has to be q-dimensional, but does not.
Time varying values are returned as arrays.
Xs |
state smoothers |
Ps |
smoother mean square error |
X0n |
initial mean smoother |
P0n |
initial smoother covariance |
J0 |
initial value of the J matrix |
J |
the J matrices |
Xp |
state predictors |
Pp |
mean square prediction error |
Xf |
state filters |
Pf |
mean square filter error |
like |
negative of the log likelihood |
innov |
innovation series |
sig |
innovation covariances |
Kn |
the value of the last Gain |
D.S. Stoffer
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
# generate some data set.seed(1) sQ = 1; sR = 3; n = 100 mu0 = 0; Sigma0 = 10; x0 = rnorm(1,mu0,Sigma0) w = rnorm(n); v = rnorm(n) x = c(x0 + sQ*w[1]); y = c(x[1] + sR*v[1]) # initialize for (t in 2:n){ x[t] = x[t-1] + sQ*w[t] y[t] = x[t] + sR*v[t] } # run and plot the smoother run = Ksmooth(y, A=1, mu0, Sigma0, Phi=1, sQ, sR) tsplot(cbind(x, y, Xs=run$Xs), spaghetti=TRUE, type='o', col=c(3,4,6), pch=c(NA,1,NA), addLegend=TRUE, location='topleft', lwd=c(2,1,2), gg=TRUE)# generate some data set.seed(1) sQ = 1; sR = 3; n = 100 mu0 = 0; Sigma0 = 10; x0 = rnorm(1,mu0,Sigma0) w = rnorm(n); v = rnorm(n) x = c(x0 + sQ*w[1]); y = c(x[1] + sR*v[1]) # initialize for (t in 2:n){ x[t] = x[t-1] + sQ*w[t] y[t] = x[t] + sR*v[t] } # run and plot the smoother run = Ksmooth(y, A=1, mu0, Sigma0, Phi=1, sQ, sR) tsplot(cbind(x, y, Xs=run$Xs), spaghetti=TRUE, type='o', col=c(3,4,6), pch=c(NA,1,NA), addLegend=TRUE, location='topleft', lwd=c(2,1,2), gg=TRUE)
Produces a grid of scatterplots of a series versus lagged values of the series.
lag1.plot(series, max.lag = 1, corr = TRUE, smooth = TRUE, col = gray(.1), bg = NA, lwl = 1, lwc = 2, bgl = NULL, ltcol = 1, box.col = NULL, cex = .9, gg = FALSE, location="topright", xname = NULL, main = NULL, ...)lag1.plot(series, max.lag = 1, corr = TRUE, smooth = TRUE, col = gray(.1), bg = NA, lwl = 1, lwc = 2, bgl = NULL, ltcol = 1, box.col = NULL, cex = .9, gg = FALSE, location="topright", xname = NULL, main = NULL, ...)
series |
the data |
max.lag |
maximum lag |
corr |
if TRUE, shows the autocorrelation value in a legend |
smooth |
if TRUE, adds a lowess fit to each scatterplot |
col |
color of points; default is |
bg |
background color for filled plot characters |
lwl |
width of lowess line; default is 1 |
lwc |
color of lowess line; default is 2 (red) |
bgl |
background of the ACF legend; default is semitransparent |
ltcol |
legend text color; default is black |
box.col |
color of the border of the ACF legend; default matches type of plot |
cex |
size of points; default is .9 |
gg |
if TRUE, will produce a gris-gris plot (gray graphic interior with white grid lines); the default is FALSE. The grammar of astsa is voodoo |
location |
the location of the ACF legend with options |
xname |
a string; name of the series to be used for axis labels. If NULL, the name of the series as input is used. |
main |
a string for the title if desired, otherwise there is no title. |
... |
additional graphical arguments |
D.S. Stoffer
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
lag1.plot(log(varve), max.lag=9, lwl=3, lwc=6, col=5, location='topleft') lag1.plot(soi, 12, pch=19, col=astsa.col(4, .3), gg=TRUE) lag1.plot(diff(log(varve)), 4, xname='V', col=6, cex=1.1, lwc=5, pch=5, main=bquote(V(t)==nabla*log(varve[t])))lag1.plot(log(varve), max.lag=9, lwl=3, lwc=6, col=5, location='topleft') lag1.plot(soi, 12, pch=19, col=astsa.col(4, .3), gg=TRUE) lag1.plot(diff(log(varve)), 4, xname='V', col=6, cex=1.1, lwc=5, pch=5, main=bquote(V(t)==nabla*log(varve[t])))
Produces a grid of scatterplots of one series versus another lagged. The first named series is the one that gets lagged.
lag2.plot(series1, series2, max.lag = 0, corr = TRUE, smooth = TRUE, col = gray(.1), bg = NA, lwl = 1, lwc = 2, bgl = NULL, ltcol = 1, box.col = NULL, cex = .9, gg = FALSE, location="topright", xname=NULL, yname=NULL, main=NULL, ...)lag2.plot(series1, series2, max.lag = 0, corr = TRUE, smooth = TRUE, col = gray(.1), bg = NA, lwl = 1, lwc = 2, bgl = NULL, ltcol = 1, box.col = NULL, cex = .9, gg = FALSE, location="topright", xname=NULL, yname=NULL, main=NULL, ...)
series1 |
first series (the one that gets lagged) |
series2 |
second series |
max.lag |
maximum number of lags |
corr |
if TRUE, shows the cross-correlation value in a legend |
smooth |
if TRUE, adds a lowess fit to each scatterplot |
col |
color of points; default is |
bg |
background color for filled plot characters |
lwl |
width of lowess line; default is 1 |
lwc |
color of lowess line; default is 2 (red) |
bgl |
background of the ACF legend; default is semitransparent |
ltcol |
legend text color; default is black |
box.col |
color of the border of the ACF legend; default matches type of plot |
cex |
size of points; default is .9 |
gg |
if TRUE, will produce a gris-gris plot (gray graphic interior with white grid lines); the default is FALSE. The grammar of astsa is voodoo |
location |
the location of the CCF legend with options |
xname, yname
|
strings for the names of the series to be used for axis labels. If NULL, the name of the series as input is used. |
main |
a string for the title if desired, otherwise there is no title. |
... |
additional graphical parameters |
D.S. Stoffer
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
lag2.plot(Hare, Lynx, max.lag=5, lwl=2, lwc=3, cex=1.5, pch=24, bg='orange') lag2.plot(soi, rec, 8, cex=1.1, pch=19, col=5, lwl=2, location="bottomleft") lag2.plot(diff(lead), diff(sales), 5, smooth=FALSE, gg=TRUE, pch=8, col=6, xname='dL', yname='dS', main='BJ Sales')lag2.plot(Hare, Lynx, max.lag=5, lwl=2, lwc=3, cex=1.5, pch=24, bg='orange') lag2.plot(soi, rec, 8, cex=1.1, pch=19, col=5, lwl=2, location="bottomleft") lag2.plot(diff(lead), diff(sales), 5, smooth=FALSE, gg=TRUE, pch=8, col=6, xname='dL', yname='dS', main='BJ Sales')
Performs lagged regression as discussed in Chapter 4.
LagReg(input, output, L = c(3, 3), M = 40, threshold = 0, inverse = FALSE)LagReg(input, output, L = c(3, 3), M = 40, threshold = 0, inverse = FALSE)
input |
input series |
output |
output series |
L |
degree of smoothing; see |
M |
must be even; number of terms used in the lagged regression |
threshold |
the cut-off used to set small (in absolute value) regression coeffcients equal to zero |
inverse |
if TRUE, will fit a forward-lagged regression |
For a bivariate series, input is the input series and output is the output series. The degree of smoothing for the spectral estimate is given by L; see spans in the help file for spec.pgram. The number of terms used in the lagged regression approximation is given by M, which must be even. The threshold value is the cut-off used to set small (in absolute value) regression coeffcients equal to zero (it is easiest to run LagReg twice, once with the default threshold of zero, and then again after inspecting the resulting coeffcients and the corresponding values of the CCF). Setting inverse=TRUE will fit a forward-lagged regression; the default is to run a backward-lagged regression. The script is based on code that was contributed by Professor Doug Wiens, Department of Mathematical and Statistical Sciences, University of Alberta.
Graphs of the estimated impulse response function, the CCF, and the output with the predicted values superimposed.
beta |
Estimated coefficients |
fit |
The output series, the fitted values, and the residuals |
See Chapter 4 of the text for an example.
D.S. Stoffer
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
LA Pollution-Mortality Study (1970-1979), weekly data.
The format is: mts [1:508, 1:11]
| columns are time series | with names |
| (1) Total Mortality | tmort
|
| (2) Respiratory Mortality | rmort
|
| (3) Cardiovascular Mortality | cmort
|
| (4) Temperature | tempr |
| (5) Relative Humidity | rh
|
| (6) Carbon Monoxide | co
|
| (7) Sulfur Dioxide | so2
|
| (8) Nitrogen Dioxide | no2
|
| (9) Hydrocarbons | hycarb
|
| (10) Ozone | o3
|
| (11) Particulates | part
|
Details may be found in http://www.sungpark.net/ShumwayAzariPawitan88.pdf
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
Original data from a study of the effects of pollution and weather on mortality, LA, 1970-1979. These are 3652 daily observations for the 10 year period. The data set is an 'xts' object indexed by Date.
The format is:
An xts object on 1970-01-01 / 1979-12-31 containing:
Data: double [3652, 11]
Columns: Tmort, Rmort, Cmort, Temp, Rhumid, CO, SO2, NO2, HC, Ozone, Part
Index: Date [3652] (TZ: "UTC")
| columns are time series | with names |
| (1) Total Mortality | Tmort
|
| (2) Respiratory Mortality | Rmort
|
| (3) Cardiovascular Mortality | Cmort
|
| (4) Temperature | Temp |
| (5) Relative Humidity | Rhumid
|
| (6) Carbon Monoxide | CO
|
| (7) Sulfur Dioxide | SO2
|
| (8) Nitrogen Dioxide | NO2
|
| (9) Hydrocarbons | HC
|
| (10) Ozone | Ozone
|
| (11) Particulates | Part
|
These are the original data from https://github.com/DSStoffer/dsstoffer.github.io/blob/main/files/LAP.pdf.
The weekly data in lap were taken from this data set last century. The details, however,
were never entirely made clear and it's too late to get them now. It is easy to pull out the
weekly averages from this data set, and how to do so is given in the Examples section below;
the resulting data set will be slightly different than lap. The names for this data set
are different from lap, the main difference is these names have capitals.
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
# if 'xts' is not installed you can still do this tsplot(timex(lap.xts), lap.xts, ncolm=3, col=astsa.col(4,wheel=TRUE,num=11), scale=.9) # differencing (on its own) loses an obs dCmort = diff(log(lap.xts[,'Cmort'])) tsplot(timex(lap.xts)[-1], dCmort, col=4, gg=TRUE) # classic IMA(1,1) acf2(dCmort, col=2:7, lwd=4) ## Not run: library(xts) # assumes package has been installed plot(lap.xts$Cmort, col=4) lapw = apply.weekly(lap.xts, FUN=colMeans) # get weekly averages plot(lapw[,c('Cmort', 'Temp', 'Part')], col=astsa.col(2:4, .7), main=NA) addLegend(col=2:4, lty=1, lwd=2, ncol=3, bty="white") sarima(lapw$Cmort, 0,1,1, no.constant=TRUE) # fit ARIMA(0,1,1) to weekly Cmort ## End(Not run)# if 'xts' is not installed you can still do this tsplot(timex(lap.xts), lap.xts, ncolm=3, col=astsa.col(4,wheel=TRUE,num=11), scale=.9) # differencing (on its own) loses an obs dCmort = diff(log(lap.xts[,'Cmort'])) tsplot(timex(lap.xts)[-1], dCmort, col=4, gg=TRUE) # classic IMA(1,1) acf2(dCmort, col=2:7, lwd=4) ## Not run: library(xts) # assumes package has been installed plot(lap.xts$Cmort, col=4) lapw = apply.weekly(lap.xts, FUN=colMeans) # get weekly averages plot(lapw[,c('Cmort', 'Temp', 'Part')], col=astsa.col(2:4, .7), main=NA) addLegend(col=2:4, lty=1, lwd=2, ncol=3, bty="white") sarima(lapw$Cmort, 0,1,1, no.constant=TRUE) # fit ARIMA(0,1,1) to weekly Cmort ## End(Not run)
Leading indicator, 150 months; taken from Box and Jenkins (1970).
data(lead)data(lead)
The format is: Time-Series [1:150] from 1 to 150: 10.01 10.07 10.32 9.75 10.33 ...
This is also the R time series BJsales.lead: The sales time series BJsales and leading indicator BJsales.lead each contain 150 observations. The objects are of class "ts".
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
This is one of the classic studies of predator-prey interactions, the 90-year data set is the number, in thousands, of lynx pelts purchased by the Hudson's Bay Company (HBC) of Canada. While this is an indirect measure of predation, the assumption is that there is a direct relationship between the number of pelts collected and the number of hare and lynx in the wild.
If you are interested in the brutal story of HBC, see the video https://www.nfb.ca/film/other_side_of_the_ledger or read the article https://canadiangeographic.ca/articles/the-untold-story-of-the-hudsons-bay-company.
The format is: Time-Series [1:91] from 1845 to 1935: 30.1 45.1 49.1 39.5 21.2 ...
The data are in units of one thousand. This data set pairs with Hare and is NOT the same as lynx.
From Odum's "Fundamentals of Ecology", p. 191. Additional information at
http://people.whitman.edu/~hundledr/courses/M250F03/M250.html
scroll down to: Chapter 6, Difference Equations
NB: For some reason, there is not a secure and encrypted version of the site above.
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
matrixpwr computes powers of a square matrix including negative powers for nonsingular matrices.
%^% is a more intuitive interface as an operator.
matrixpwr(A, power) A %^% powermatrixpwr(A, power) A %^% power
A |
a square matrix |
power |
single numeric |
Raises matrix to the specified power. The matrix must be square
and if power < 0, the matrix must be nonsingular.
Note that %^% is defined as
"%^%" <- function(A, power) matrixpwr(A, power)
If power = 0, the identity matrix is returned.
Returns matrix raised to the given power.
D.S. Stoffer
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
# 2-state Markov transition matrix ( P = matrix(c(.7,.4,.3,.6), 2) ) # moving to steady state P %^% 5 P %^% 10 # surround with parentheses if used in an expression c(.2, .8) %*% (P %^% 50) # Inverse square root var(econ5) %^% -.5# 2-state Markov transition matrix ( P = matrix(c(.7,.4,.3,.6), 2) ) # moving to steady state P %^% 5 P %^% 10 # surround with parentheses if used in an expression c(.2, .8) %*% (P %^% 50) # Inverse square root var(econ5) %^% -.5
Bimonthly MEI values, starting with Dec1949/Jan1950 through Oct/Nov2019.
All values are normalized for each bimonthly season so that the 44 values from 1950 to 1993
have an average of zero and a standard deviation of 1. Larger values correspond to warmer
temperatures (unlike soi and ENSO).
The format is: Time-Series [1:827] from 1950 to 2019: -1.03 -1.13 -1.28 -1.07 -1.43 ...
For full details, see https://psl.noaa.gov/enso/mei.old/mei.html. Multivariate ENSO Index (MEI) is a combined score on the six main observed variables over the tropical Pacific. These six variables are: sea-level pressure (P), zonal (U) and meridional (V) components of the surface wind, sea surface temperature (S), surface air temperature (A), and total cloudiness fraction of the sky (C). These observations have been collected and published in ICOADS for many years. The MEI is computed separately for each of twelve sliding bi-monthly seasons (Dec/Jan, Jan/Feb,..., Nov/Dec). After spatially filtering the individual fields into clusters, the MEI is calculated as the first unrotated Principal Component (PC) of all six observed fields combined. This is accomplished by normalizing the total variance of each field first, and then performing the extraction of the first PC on the co-variance matrix of the combined fields. In order to keep the MEI comparable, all seasonal values are standardized with respect to each season and to the 1950-93 reference period.
Weak El Nino: MEI is between +0.5 and +1.0.
Moderate El Nino: MEI is between +1.0 and +1.5.
Strong El Nino: MEI is between +1.5 and +2.0.
Very Strong El Nino: MEI is at or above +2.0.
Values below the negative of these indicate La Nina conditions.
https://psl.noaa.gov/enso/mei.old/table.html
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
tsplot(cbind(MEI, MEI2), spag=TRUE, col=2*2:1, addLegend=TRUE, nym=2, gg=TRUE) tspairs(ts.intersect(MEI, MEI2), location='top')tsplot(cbind(MEI, MEI2), spag=TRUE, col=2*2:1, addLegend=TRUE, nym=2, gg=TRUE) tspairs(ts.intersect(MEI, MEI2), location='top')
Bimonthly MEI values (version 2), starting with Dec1978/Jan1979 through Apr/May2025.
These data are similar to MEI and larger values correspond to warmer
temperatures (unlike soi and ENSO).
The format is: Time-Series [1:557] from 1979 to 2025: 0.47 0.29 -0.05 0.21 0.27 -0.11 -0.11 0.47 0.38 0.23 ...
For details, see https://www.psl.noaa.gov/enso/mei and MEI, which is version 1.
The key differences between MEI version 2 and version 1 are the input variables used, the source of the data, and the dates of the historical record. MEI version 2 relies on reanalysis data using modern numerical weather models to process and combine historical weather observations into a comprehensive, globally complete, and consistent dataset of past weather and climate and satellite data. This eliminates inconsistencies caused by relying on potentially less reliable ship observations, especially in earlier decades. The switch from cloud cover fraction to Outgoing Longwave Radiation (OLR) provides a more direct and accurate measurement of atmospheric convection, a critical component of ENSO. Despite the differences, MEI version 2 and the original MEI version 1 are very highly correlated for the overlapping period.
Weak El Nino: MEI is between +0.5 and +1.0.
Moderate El Nino: MEI is between +1.0 and +1.5.
Strong El Nino: MEI is between +1.5 and +2.0.
Very Strong El Nino: MEI is at or above +2.0.
Values below the negative of these indicate La Nina conditions.
https://www.psl.noaa.gov/enso/mei
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
tsplot(cbind(MEI, MEI2), spag=TRUE, col=2*2:1, addLegend=TRUE, nym=2, gg=TRUE) tspairs(ts.intersect(MEI, MEI2), location='top')tsplot(cbind(MEI, MEI2), spag=TRUE, col=2*2:1, addLegend=TRUE, nym=2, gg=TRUE) tspairs(ts.intersect(MEI, MEI2), location='top')
Provides labels for the (English) months of the year to be used in plotting monthly time series.
The format is: chr [1:12] "J" "F" "M" "A" "M" "J" "J" "A" "S" "O" "N" "D"
Hi Kids. The months of the year in English are:
January, February, March, April, May, June, July, August, September, October, November, December.
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
sAR = sarima.sim(sar=.9, S=12, n=36) tsplot(sAR, type='c') points(sAR, pch=Months, cex=1.1, font=4, col=1:4)sAR = sarima.sim(sar=.9, S=12, n=36) tsplot(sAR, type='c') points(sAR, pch=Months, cex=1.1, font=4, col=1:4)
This is spec.pgram with a number changes and written so you can easily extract the estimate of the multivariate spectral matrix as fxx. The bandwidth calculation has been changed to the more practical definition given in the text and this can be used to replace spec.pgram.
mvspec(x, spans = NULL, kernel = NULL, taper = 0, pad = 0, fast = TRUE, demean = FALSE, detrend = TRUE, lowess = FALSE, log = 'n', plot = TRUE, gg = FALSE, type = NULL, na.action = na.fail, nxm = 2, nym = 1, main = NULL, xlab = NULL, cex.main = NULL, ci = .95, ci.col = 4, plot.type, report=TRUE, ...)mvspec(x, spans = NULL, kernel = NULL, taper = 0, pad = 0, fast = TRUE, demean = FALSE, detrend = TRUE, lowess = FALSE, log = 'n', plot = TRUE, gg = FALSE, type = NULL, na.action = na.fail, nxm = 2, nym = 1, main = NULL, xlab = NULL, cex.main = NULL, ci = .95, ci.col = 4, plot.type, report=TRUE, ...)
x |
univariate or multivariate time series (i.e., the p columns of x are time series) |
spans |
vector of odd integers giving the widths of modified Daniell smoothers to be used to smooth the periodogram |
kernel |
alternatively, a kernel smoother of class |
taper |
specifies the proportion of data to taper using a split cosine bell taper (.5 specifies a full taper) |
pad |
proportion of data to pad (zeros are added to the end of the series to increase its length by the proportion pad) |
fast |
logical; if TRUE, pad the series to a highly composite length |
demean |
if TRUE, series is demeaned first |
detrend |
if TRUE, series is detrended first (unless demean is TRUE) |
lowess |
if TRUE and detrend TRUE (and demean FALSE), series is detrended using lowess first |
log |
if |
plot |
plot the estimated spectra |
gg |
if TRUE, will produce a gris-gris plot (gray graphic interior with white grid lines); the default is FALSE. The grammar of astsa is voodoo |
type |
type of plot to be drawn, defaults to lines (see |
na.action |
how to handle missing values |
nxm, nym
|
the number of minor tick mark divisions on x-axis, y-axis; the default is one minor tick on the x-axis and none on the y-axis |
main |
title of the graphics; if NULL (default), a totally awesome title is generated dude, but if NA there will be no gnarly title and the top margin will be used for the plot |
xlab |
label for frequency axis; if NULL (default), a totally awesome label is generated for your viewing pleasure |
cex.main |
magnification for main title; default is 1. |
ci |
confidence level if one is drawn. |
ci.col |
color of the confidence interval if one is drawn. |
plot.type |
plot type for multivariate time series; leave blank or specify 'marginal' if a marginal plot of the spectra is desired, or set |
report |
if TRUE (default), prints bandwidth, degrees of freedom, and amount of tapering to screen |
... |
additional graphical arguments. |
This is built off of spec.pgram from the stats package with a few changes in the defaults and written so you can easily extract the estimate of the multivariate spectral matrix as fxx.
The default for the plot is NOT to plot on a log scale and the graphic will have a grid. Overall, the graphics have been improved.
The bandwidth calculation has been changed to the more practical definition given in the text, . Also, the bandwidth is not displayed in the graphic, but is returned.
Although initially meant to be used to easily obtain multivariate (mv) spectral (spec) estimates, this script can be used for univariate time series as a replacement for spec.pgram.
Note that the script does not taper by default (taper=0); this forces the user to do "conscious tapering".
In the multivariate case (more than 2 series), if "coherency" or "phase" plots are desired, the result is a grid of plots. There is a "scale" factor that can be set to prevent the labels from getting too small if there are many series. The default is scale=1, and to expand the labels by 10% for example, set scale=1.1. Also, if there are many series, having minor tick marks can make the graphic look crowded; in this case, set minor=FALSE. Finally, the plots include a type of legend that shows the axes with their corresponding labels (by default). To turn the legend off, include addLegend=FALSE in the call. Again, these considerations only work in the multivariate case (more than 2 series).
All results are returned invisibly.
If plot is TRUE and smoothing is used, the bandwidth, degrees of freedom, and taper amount are printed.
An object of class "spec", which is a list containing at least the following components:
fxx |
spectral matrix estimates; an array of dimensions |
freq |
vector of frequencies at which the spectral density is estimated. |
spec |
vector (for univariate series) or matrix (for multivariate series) of estimates of the spectral density at frequencies corresponding to freq. |
details |
matrix with columns: frequency, period, spectral ordinate(s) |
coh |
NULL for univariate series. For multivariate time series, a matrix containing the squared coherency between different series. Column i + (j - 1) * (j - 2)/2 of coh contains the squared coherency between columns i and j of x, where i < j. |
phase |
NULL for univariate series. For multivariate time series a matrix containing the cross-spectrum phase between different series. The format is the same as coh. |
Lh |
Number of frequencies (approximate) used in the band. |
n.used |
Sample length used for the FFT |
df |
Degrees of freedom (may be approximate) associated with the spectral estimate. |
bandwidth |
Bandwidth (may be approximate) associated with the spectral estimate. |
method |
The method used to calculate the spectrum. |
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
# real raw periodogram mvspec(soi) mvspec(soi, log='y') # on a log scale # smooth and some details printed mvspec(soi, spans=c(7,7), taper=.1)$details[1:45,] # bivariate example deth = cbind(mdeaths, fdeaths) # two R data sets, male/female monthly deaths ... tsplot(deth, type='b', col=c(4,6), spaghetti=TRUE, pch=c('M','F'), addLegend=TRUE) dog = mvspec(deth, spans=c(3,3), taper=.1) dog$fxx[,,1:5] # look at a few spectral matrix estimates dog$bandwidth # bandwidth with time unit = year dog$df # degrees of freedom mvspec(deth, spans=c(3,3), taper=.1, plot.type='coh') # coherence # multivariate example mvspec(diff(log(econ5)), spans=c(5,5), col=5, lwd=2, ci=NA, gg=TRUE, minor=FALSE, plot.type='coh') mvspec(diff(log(econ5)), spans=c(5,5), col=5, lwd=2, ci=NA, gg=TRUE, minor=FALSE, plot.type='coh', addLegend=FALSE)# real raw periodogram mvspec(soi) mvspec(soi, log='y') # on a log scale # smooth and some details printed mvspec(soi, spans=c(7,7), taper=.1)$details[1:45,] # bivariate example deth = cbind(mdeaths, fdeaths) # two R data sets, male/female monthly deaths ... tsplot(deth, type='b', col=c(4,6), spaghetti=TRUE, pch=c('M','F'), addLegend=TRUE) dog = mvspec(deth, spans=c(3,3), taper=.1) dog$fxx[,,1:5] # look at a few spectral matrix estimates dog$bandwidth # bandwidth with time unit = year dog$df # degrees of freedom mvspec(deth, spans=c(3,3), taper=.1, plot.type='coh') # coherence # multivariate example mvspec(diff(log(econ5)), spans=c(5,5), col=5, lwd=2, ci=NA, gg=TRUE, minor=FALSE, plot.type='coh') mvspec(diff(log(econ5)), spans=c(5,5), col=5, lwd=2, ci=NA, gg=TRUE, minor=FALSE, plot.type='coh', addLegend=FALSE)
Returns of the New York Stock Exchange (NYSE) from February 2, 1984 to December 31, 1991.
The format is: Time-Series [1:2000] from 1 to 2000: 0.00335 -0.01418 -0.01673 0.00229 -0.01692 ...
Various packages have data sets called nyse. Consequently, it may be best to specify this data set as nyse = astsa::nyse to avoid conflicts.
Most likely from the S+GARCH module - Version 1.1 Release 2: 1998
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
Crude oil, WTI spot price FOB (in dollars per barrel), weekly data from 2000 to mid-2010.
The format is: Time-Series [1:545] from 2000 to 2010: 26.2 26.1 26.3 24.9 26.3 ...
pairs with the series gas
Data were obtained from the URL: www.eia.doe.gov/dnav/pet/pet_pri_spt_s1_w.htm
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
tsplot(cbind(gas,oil), spag=TRUE, col=2*1:2, addLegend=TRUE)tsplot(cbind(gas,oil), spag=TRUE, col=2*1:2, addLegend=TRUE)
Particulate series corresponding to cmort from the LA pollution study.
The format is: Time-Series [1:508] from 1970 to 1980: 72.7 49.6 55.7 55.2 66 ...
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
PLT: Measurements made for 91 days on the three variables, log(white blood count) [WBC], log(platelet) [PLT] and hematocrit [HCT]. Missing data code is 0 (zero).
data(PLT)data(PLT)
The format is: Time-Series [1:91] from 1 to 91: 4.47 4.33 4.09 4.6 4.41 ...
See Examples 6.1 and 6.9 for more details.
Jones, R.H. (1984). Fitting multivariate models to unequally spaced data. In Time Series Analysis of Irregularly Observed Data, pp. 158-188. E. Parzen, ed. Lecture Notes in Statistics, 25, New York: Springer-Verlag.
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
Monthly time series of poliomyelitis cases reported to the U.S. Centers for Disease Control for the years 1970 to 1983, 168 observations.
The format is: Time-Series [1:168] from 1970 to 1984: 0 1 0 0 1 3 9 2 3 5 ...
The data were originally modelled by Zeger (1988) “A Regression Model for Time Series of Counts,” Biometrika, 75, 822-835.
Data taken from the gamlss.data package; see https://www.gamlss.com/.
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
tsplot(polio, type='s')tsplot(polio, type='s')
Multiplication of two polynomials.
polyMul(p, q)polyMul(p, q)
p |
coefficients of first polynomial |
q |
coefficients of second polynomial |
inputs are vectors of coefficients a, b, c, ..., in order of power
coefficients of the product in order of power
D.S. Stoffer
based on code from the polynom package https://CRAN.R-project.org/package=polynom
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
a = 1:3 # 1 + 2x + 3x^2 b = 1:2 # 1 + 2x polyMul(a, b) # 1 + 4x + 7x^2 + 6x^3a = 1:3 # 1 + 2x + 3x^2 b = 1:2 # 1 + 2x polyMul(a, b) # 1 + 4x + 7x^2 + 6x^3
Performs a cross-correlation analysis on two series after prewhitening the first series and filtering the second series accordingly.
pre.white(series1, series2, diff = FALSE, max.lag = NULL, main = NULL, order.max = NULL, plot = TRUE, ...)pre.white(series1, series2, diff = FALSE, max.lag = NULL, main = NULL, order.max = NULL, plot = TRUE, ...)
series1, series2
|
univariate time series |
diff |
(logical or integer) should the series be differenced prior to the analysis and if more than first order, by how much |
max.lag |
maximum lag for which to plot the CCF - if NULL, a suitable number is chosen (see details) |
main |
plot title - if NULL, uses series1 name appended by .w for whitened and series2 name appended by .f for filtered |
order.max |
maximum order of model to fit (see details) |
plot |
should the sample CCF be plotted |
... |
additional graphic arguments |
The first series is prewhitened by fitting a long AR based on AIC and the second series is filtered appropriately. Then a cross-correlation analysis is performed via ccf2. If differencing is specified, both series are differenced the same way prior to the prewhitening. The resulting series are returned invisibly.
The default is no differencing. Differences of order 1 can be set be entering diff = TRUE or diff = 1. If it is necessary to use higher orders, then enter a positive integer (this is rare).
The maximum lag (max.lag) in the CCF graphic defaults (if NULL) to the smaller of 50 and 20% of the sample size.
The maximum order (order.max) for fitting the AR via AIC defaults (if NULL) to the minimum of 30 and 15% of the number of observations.
Returns the sample CCF graphic using the prewhitened series unless plot = FALSE. The prewhitened series are returned invisibly.
D.S. Stoffer
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
pre.white(cmort, part, diff=TRUE, col=4)pre.white(cmort, part, diff=TRUE, col=4)
Monthly Federal Reserve Board Production Index (1948-1978, n = 372 months).
data(prodn)data(prodn)
The format is: Time-Series [1:372] from 1948 to 1979: 40.6 41.1 40.5 40.1 40.4 41.2 39.3 41.6 42.3 43.2 ...
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
Quarterly inflation rate in the Consumer Price Index from 1953-Ito 1980-II, n = 110 observations.
The format is: Time-Series [1:110] from 1953 to 1980: 1.673 3.173 0.492 -0.327 -0.333 ...
pairs with qintr (interest rate)
Newbold, P. and T. Bos (1985). Stochastic Parameter Regression Models. Beverly Hills: Sage.
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
Quarterly interest rate recorded for Treasury bills from 1953-Ito 1980-II, n = 110 observations.
The format is: Time-Series [1:110] from 1953 to 1980: 1.98 2.15 1.96 1.47 1.06 ...
pairs with qinfl (inflation)
Newbold, P. and T. Bos (1985). Stochastic Parameter Regression Models. Beverly Hills: Sage.
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
Produces a normal QQ plot with a line of equality and a confidence band (by default) of the input data. This is basically a prettier version of qqnorm from the stats package.
QQnorm(xdata, col = c(4, 6), ylab = "Sample Quantiles", xlab = "Theoretical Quantiles", main = "Normal Q-Q Plot", ylim = NULL, ci = TRUE, qqlwd = 1, ...)QQnorm(xdata, col = c(4, 6), ylab = "Sample Quantiles", xlab = "Theoretical Quantiles", main = "Normal Q-Q Plot", ylim = NULL, ci = TRUE, qqlwd = 1, ...)
xdata |
the data. If a matrix, the data are collapsed. |
col |
vector of 2, first is point color, second is line color (default is blue-4 and magenta-6). |
ylab |
y-axis label (default is 'Sample Quantiles'). |
xlab |
x-axis label (default is 'Theoretical Quantiles'). |
main |
plot title (default is 'Normal Q-Q Plot') |
ylim |
limits on y-axis (default is the most beautiful limits ever). |
ci |
if TRUE (default) draws pointwise 99.99% CIs as a band.
If FALSE or 0, no CI is drawn. Alternately, enter a percentage
(e.g., either |
qqlwd |
line width of the qqline (default is 1). |
... |
other graphical parameters sent to |
If you want a graphic to check normality of your data in xdata, just enter QQnorm(xdata) and sit back and enjoy the beauty of this script (you may want to wear sunglasses).
For confidence levels, various values are allowed. For example, 95% limits can be obtained as ci=95 or ci=.95, both of which are conventional. However, ci=5, or ci=.05 will also work for 95% intervals (so you can not go below 50%). If you ask for a confidence level of 100% or larger, you will get the default without a warning and maybe you are unconventional.
D.S. Stoffer
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
QQnorm(log(varve))QQnorm(log(varve))
Recruitment (index of the number of new fish) for a period of 453 months ranging over the years 1950-1987. Recruitment is loosely defined as an indicator of new members of a population to the first life stage at which natural mortality stabilizes near adult levels.
data(rec)data(rec)
The format is: Time-Series [1:453] from 1950 to 1988: 68.6 68.6 68.6 68.6 68.6 ...
can pair with soi (Southern Oscillation Index)
Data furnished by Dr. Roy Mendelssohn of the Pacific Fisheries Environmental Laboratory, NOAA (personal communication). Further discussion of the concept of Recruitment may be found here: derekogle.com/fishR/examples/oldFishRVignettes/StockRecruit.pdf
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
Sales, 150 months; taken from Box and Jenkins (1970).
The format is: Time-Series [1:150] from 1 to 150: 200 200 199 199 199 ...
This is also the R data set BJsales: The sales time series BJsales and leading indicator BJsales.lead each contain 150 observations. The objects are of class "ts".
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
Farm Bred Norwegian Salmon, export price, US Dollars per Kilogram
The format is: Time-Series [1:166] from September 2003 to June 2017: 2.88 3.16 2.96 3.12 3.23 3.32 3.45 3.61 3.48 3.21 ...
https://www.indexmundi.com/commodities/
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
Salt profiles taken over a spatial grid set out on an agricultural field, 64 rows at 17-ft spacing.
data(salt)data(salt)
The format is: Time-Series [1:64] from 1 to 64: 6 6 6 3 3 3 4 4 4 1.5 ...
pairs with saltemp, temperature profiles on the same grid
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
Temperature profiles over a spatial grid set out on an agricultural field, 64 rows at 17-ft spacing.
data(saltemp)data(saltemp)
The format is: Time-Series [1:64] from 1 to 64: 5.98 6.54 6.78 6.34 6.96 6.51 6.72 7.44 7.74 6.85 ...
pairs with salt, salt profiles on the same grid
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
Fits ARIMA models (with diagnostics) in a short command. It can also be used to perform regression with autocorrelated errors.
sarima(xdata, p, d, q, P = 0, D = 0, Q = 0, S = -1, details = TRUE, xreg = NULL, Model = TRUE, fixed = NULL, tol = sqrt(.Machine$double.eps), no.constant = FALSE, col, fitdf, ...)sarima(xdata, p, d, q, P = 0, D = 0, Q = 0, S = -1, details = TRUE, xreg = NULL, Model = TRUE, fixed = NULL, tol = sqrt(.Machine$double.eps), no.constant = FALSE, col, fitdf, ...)
xdata |
univariate time series |
p |
AR order |
d |
difference order |
q |
MA order |
P |
SAR order; use only for seasonal models |
D |
seasonal difference; use only for seasonal models |
Q |
SMA order; use only for seasonal models |
S |
seasonal period; use only for seasonal models |
details |
if FALSE, turns off the diagnostic plot and the output from the nonlinear optimization routine, which is |
xreg |
Optionally, a vector or matrix of external regressors, which must have the same number of rows as xdata. |
Model |
if TRUE (default), the model orders are printed on the diagnostic plot. |
fixed |
optional numeric vector of the same length as the total number of parameters. If supplied, only parameters corresponding to NA entries will be estimated. |
tol |
controls the relative tolerance (reltol in |
no.constant |
controls whether or not sarima includes a constant in the model. In particular, if there is no differencing (d = 0 and D = 0) you get the mean estimate. If there is differencing of order one (either d = 1 or D = 1, but not both), a constant term is included in the model. These two conditions may be overridden (i.e., no constant will be included in the model) by setting this to TRUE; e.g., |
col |
color of diagnostic plots; default is 1 (black) |
fitdf |
number of degrees of freedom to be subtracted for the Ljung-Box test if xdata is a series of residuals and all orders are zero (see details). Does not have to be specified if it is zero (0). |
... |
additional graphical arguments |
If your time series is in x and you want to fit an ARIMA(p,d,q) model to the data, the basic call is sarima(x,p,d,q). As of version 2.3, the orders do not have to be specified if they are zero. For example, sarima(x, p=1) is the same as sarima(x,1,0,0).
To fit a seasonal ARIMA model, the basic call is sarima(x,p,d,q,P,D,Q,S). For example, sarima(x, 2,1,0, 0,1,1,12) will fit a seasonal ARIMA model to the series in x. The orders do not have to be specified if they are zero; e.g., sarima(x, d=1,q=1, D=1,Q=1,S=4) works.
The results are the parameter estimates, standard errors, AIC, AICc, BIC and diagnostics. The difference between the information criteria given by sarima() and arima() is that they differ by a scaling factor of the effective sample size.
The script may be used for a residual analysis by running it without specifying any orders. In this case, it may be necessary to specify fitdf to get the correct degrees of freedom such as in fitting a state space model.
A t-table, the estimated noise variance, and AIC, AICc, BIC are printed. The following are returned invisibly as a list:
fit |
[[1]] an object of class |
sigma2 |
[[2]] the estimate of the noise variance |
degrees_of_freedom |
[[3]] error degrees of freedom |
t.table |
[[4]] a little t-table with two-sided p-values |
ICs |
[[5]] AIC - AICc - BIC |
Yes it's ok if input as NA and the observations are vector or ts objects (meaning equally spaced).
This is an enhancement of arima from the stats package.
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
# easy to use sarima(rec, 2,0,0) # data, p, d, and q # redux - minimal output sarima(rec, p=2, details=FALSE) # fun for the whole family dog = sarima(log(AirPassengers), 0,1,1, 0,1,1,12, details=FALSE) # dog[[1]] has most of the results ... tsplot(resid(dog[[1]])) # fixed parameters x = sarima.sim( ar=c(0,-.9), n=200 ) + 50 sarima(x, p=2, fixed=c(0,NA,NA)) # phi1 fixed, phi2 and mean free # regression with autocorrelated errors sarima(log(cpg), p=1, xreg=time(cpg)) # missing data (color, gris-gris, and pch, added for fun) sarima(ar1miss, p=1, col=4, gg=TRUE, pch=19)# easy to use sarima(rec, 2,0,0) # data, p, d, and q # redux - minimal output sarima(rec, p=2, details=FALSE) # fun for the whole family dog = sarima(log(AirPassengers), 0,1,1, 0,1,1,12, details=FALSE) # dog[[1]] has most of the results ... tsplot(resid(dog[[1]])) # fixed parameters x = sarima.sim( ar=c(0,-.9), n=200 ) + 50 sarima(x, p=2, fixed=c(0,NA,NA)) # phi1 fixed, phi2 and mean free # regression with autocorrelated errors sarima(log(cpg), p=1, xreg=time(cpg)) # missing data (color, gris-gris, and pch, added for fun) sarima(ar1miss, p=1, col=4, gg=TRUE, pch=19)
ARIMA forecasting.
sarima.for(xdata, n.ahead, p, d, q, P=0, D=0, Q=0, S=-1, tol = sqrt(.Machine$double.eps), no.constant = FALSE, plot = TRUE, plot.all = FALSE, ylab = NULL, xreg = NULL, newxreg = NULL, fixed = NULL, pcol = 2, pch = 1, ...)sarima.for(xdata, n.ahead, p, d, q, P=0, D=0, Q=0, S=-1, tol = sqrt(.Machine$double.eps), no.constant = FALSE, plot = TRUE, plot.all = FALSE, ylab = NULL, xreg = NULL, newxreg = NULL, fixed = NULL, pcol = 2, pch = 1, ...)
xdata |
univariate time series |
n.ahead |
forecast horizon (number of periods) |
p |
AR order |
d |
difference order |
q |
MA order |
P |
SAR order; use only for seasonal models |
D |
seasonal difference; use only for seasonal models |
Q |
SMA order; use only for seasonal models |
S |
seasonal period; use only for seasonal models |
tol |
controls the relative tolerance (reltol) used to assess convergence. The default is |
no.constant |
controls whether or not a constant is included in the model. If |
plot |
if TRUE (default) the data (or some of it) and the forecasts and bounds are plotted |
plot.all |
if TRUE, all the data are plotted in the graphic; otherwise, only the last 100 observations are plotted in the graphic. |
ylab |
if NULL (default), the y-axis label is the name of the series. |
xreg |
Optionally, a vector or matrix of external regressors, which must have the same number of rows as the series. If this is used, |
newxreg |
New values of |
fixed |
optional numeric vector of the same length as the total number of parameters. If supplied, only parameters corresponding to NA entries will be estimated. |
pcol |
color of the predictions in the graphic. |
pch |
plot character for the graphic. If |
... |
additional graphical arguments |
For example, sarima.for(x, 5, 1,0,1) or sarima.for(x, 5, p=1, q=1)
will forecast five time points ahead for an ARMA(1,1) fit to x. The output prints the forecasts and the standard errors of the forecasts, and supplies a graphic of the forecast with +/- 1 and 2 prediction error bounds.
pred |
the forecasts |
se |
the prediction (standard) errors |
Yes it's ok if input as NA and the observations are vector or ts objects (meaning equally spaced). In this case, the graphic includes a line with points. Otherwise, lone observations would not be visible.
If plot.all=TRUE, the data are displayed as a line only unless there are missing observations; see the Missing Data section. Points (and more) can be added to the graphic as long as the device stays open. For example:
sarima.for(gtemp_land, 10, d=1, q=1, plot.all=TRUE, pch=19) points(gtemp_land, pch=20, col=4) abline(v=2024, col=6, lty=5) text(2000, 2.2, "it's getting hot in here", font=2, col=6, srt=45)
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
sarima.for(gtemp_both, n.ahead=6, d=1, q=1, col=6, pcol=4, gg=TRUE) # with regressors nummy = length(soi) n.ahead = 24 nureg = time(soi)[nummy] + seq(1,n.ahead)/12 sarima.for(soi, n.ahead, 2,0,0, 2,0,0,12, xreg=time(soi), newxreg=nureg) # missing data sarima.for(ar1miss, n.ahead=5, p=1, pch=19)sarima.for(gtemp_both, n.ahead=6, d=1, q=1, col=6, pcol=4, gg=TRUE) # with regressors nummy = length(soi) n.ahead = 24 nureg = time(soi)[nummy] + seq(1,n.ahead)/12 sarima.for(soi, n.ahead, 2,0,0, 2,0,0,12, xreg=time(soi), newxreg=nureg) # missing data sarima.for(ar1miss, n.ahead=5, p=1, pch=19)
Simulate data from (seasonal) ARIMA models.
sarima.sim(ar = NULL, d = 0, ma = NULL, sar = NULL, D = 0, sma = NULL, S = NULL, n = 500, rand.gen = rnorm, innov = NULL, burnin = NA, t0 = 0, red.tol=.1, ...)sarima.sim(ar = NULL, d = 0, ma = NULL, sar = NULL, D = 0, sma = NULL, S = NULL, n = 500, rand.gen = rnorm, innov = NULL, burnin = NA, t0 = 0, red.tol=.1, ...)
ar |
coefficients of AR component (does not have to be specified) |
d |
order of regular difference (does not have to be specified) |
ma |
coefficients of MA component (does not have to be specified) |
sar |
coefficients of SAR component (does not have to be specified) |
D |
order of seasonal difference (does not have to be specified) |
sma |
coefficients of SMA component (does not have to be specified) |
S |
seasonal period (does not have to be specified) |
n |
desired sample size (defaults to 500) |
rand.gen |
optional; a function to generate the innovations (defaults to normal) |
innov |
an optional times series of innovations. If not provided, rand.gen is used. |
burnin |
length of burn-in (a non-negative integer). If |
t0 |
start time (defaults to 0) |
red.tol |
tolerance for reporting parameter redundancy (default is .1 - set to 0 to avoid check) |
... |
additional arguments applied to the innovations. For |
Will generate a time series of length n from the specified SARIMA model using simplified input.
The use of the term mean under the '...' argument refers to the generation of normal innovations. For example, sarima.sim(ar=.9, mean=5) will generate data using N(5,1) or 5+N(0,1) innovations, so that the constant in the model is 5 and the mean of the AR model is 5/(1-.9) = 50. In sarima.sim(ma=.9, mean=5), however, the model mean is 5 (the constant). Also, a random walk with drift = .1 can be generated by sarima.sim(d=1, mean=.1, burnin=0), which is equivalent to cumsum(rnorm(500, mean=.1)). The same story goes if sd is specified; i.e., it's applied to the innovations. Because anything specified in ... refers to the innovations, a simpler way to generate a non-zero mean is to add the value outside the call; see the examples.
If innov is used to input the innovations and override rand.gen, be sure that length(innov) is at least n + burnin. If the criterion is not met, the script will return less than the desired number of values and a warning will be given.
A time series of length n from the specified SARIMA model with the specified frequency if the model is seasonal and start time t0.
The model autoregressive polynomial ('AR side' = AR x SAR) is checked for causality and the model moving average polynomial ('MA side' = MA x SMA) is checked invertibility. The script stops and reports an error at the first violation of causality or invertibility; i.e., it will not report multiple errors.
Overparameterization is also checked. To evaluate parameter redundancy, the inverse roots of the (S)AR and (S)MA polynomials are examined for closeness with red.tol determining closeness. This can be shut off by setting red.tol=0.
D.S. Stoffer
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
## AR(2) with mean 50 [n = 500 is default] y = sarima.sim(ar=c(1.5,-.75)) + 50 tsplot(y) ## ARIMA(0,1,1) with drift ['mean' refers to the innovations] tsplot(sarima.sim(ma=-.8, d=1, mean=.25)) ## Overparameterized White Noise tsplot(sarima.sim(ar=.9, ma=-.9)) ## SAR(1) example from text set.seed(10101010) x = sarima.sim(sar=.95, S=12, n=37) + 5 tsplot(x, type='c') points(x, pch=Months, cex=1.5, font=2, col=1:12) ## SARIMA(0,1,1)x(0,1,1)_12 - B&J's favorite set.seed(101010) tsplot(sarima.sim(d=1, ma=-.4, D=1, sma=-.6, S=12, n=120)) ## infinite variance t-errors tsplot(sarima.sim(ar=.9, rand.gen=function(n, ...) rt(n, df=2) )) ## use your own innovations dog = rexp(150, rate=.5)*sign(runif(150,-1,1)) tsplot(sarima.sim(n=100, ar=.99, innov=dog, burnin=50)) ## generate seasonal data but no P, D or Q - you will receive ## a message to make sure that you wanted to do this on purpose: tsplot(sarima.sim(ar=c(1.5,-.75), n=144, S=12), ylab='doggy', xaxt='n') mtext(seq(0,144,12), side=1, line=.5, at=0:12)## AR(2) with mean 50 [n = 500 is default] y = sarima.sim(ar=c(1.5,-.75)) + 50 tsplot(y) ## ARIMA(0,1,1) with drift ['mean' refers to the innovations] tsplot(sarima.sim(ma=-.8, d=1, mean=.25)) ## Overparameterized White Noise tsplot(sarima.sim(ar=.9, ma=-.9)) ## SAR(1) example from text set.seed(10101010) x = sarima.sim(sar=.95, S=12, n=37) + 5 tsplot(x, type='c') points(x, pch=Months, cex=1.5, font=2, col=1:12) ## SARIMA(0,1,1)x(0,1,1)_12 - B&J's favorite set.seed(101010) tsplot(sarima.sim(d=1, ma=-.4, D=1, sma=-.6, S=12, n=120)) ## infinite variance t-errors tsplot(sarima.sim(ar=.9, rand.gen=function(n, ...) rt(n, df=2) )) ## use your own innovations dog = rexp(150, rate=.5)*sign(runif(150,-1,1)) tsplot(sarima.sim(n=100, ar=.99, innov=dog, burnin=50)) ## generate seasonal data but no P, D or Q - you will receive ## a message to make sure that you wanted to do this on purpose: tsplot(sarima.sim(ar=c(1.5,-.75), n=144, S=12), ylab='doggy', xaxt='n') mtext(seq(0,144,12), side=1, line=.5, at=0:12)
Draws a scatterplot with histograms in the margins.
scatter.hist(x, y, xlab = NULL, ylab = NULL, title = NULL, pt.size = 1, hist.col = gray(0.82), pt.col = gray(0.1, 0.25), pch = 19, reset.par = TRUE, ...)scatter.hist(x, y, xlab = NULL, ylab = NULL, title = NULL, pt.size = 1, hist.col = gray(0.82), pt.col = gray(0.1, 0.25), pch = 19, reset.par = TRUE, ...)
x |
vector of x-values |
y |
corresponding vector of y-values |
xlab |
x-axis label (defaults to name of x) |
ylab |
y-axis label (defaults to name of y) |
title |
plot title (optional) |
pt.size |
size of points in scatterplot |
hist.col |
color for histograms |
pt.col |
color of points in scatterplot |
pch |
scatterplot point character |
reset.par |
reset graphics - default is TRUE; set to FALSE to add on to scatterplot |
... |
addtional graphical parameters sent to |
D.S. Stoffer
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
scatter.hist(tempr, cmort, hist.col=astsa.col(5,.4), pt.col=5, pt.size=1.5, reset=FALSE) lines(lowess(tempr, cmort), col=6) scatter.hist(diff(log(econ5[,'gnp'])), diff(log(econ5[,'unemp'])), nxm=5, pt.size=2, col=astsa.col(6,.1), pt.col=astsa.col(4, alpha=.6, wheel=TRUE, num=25), hist='green3')scatter.hist(tempr, cmort, hist.col=astsa.col(5,.4), pt.col=5, pt.size=1.5, reset=FALSE) lines(lowess(tempr, cmort), col=6) scatter.hist(diff(log(econ5[,'gnp'])), diff(log(econ5[,'unemp'])), nxm=5, pt.size=2, col=astsa.col(6,.1), pt.col=astsa.col(4, alpha=.6, wheel=TRUE, num=25), hist='green3')
Performs signal extraction and optimal filtering as discussed in Chapter 4.
SigExtract(series, L = c(3, 3), M = 50, max.freq = 0.05, col = 4)SigExtract(series, L = c(3, 3), M = 50, max.freq = 0.05, col = 4)
series |
univariate time series to be filtered |
L |
degree of smoothing (may be a vector); see |
M |
number of terms used in the lagged regression approximation |
max.freq |
truncation frequency, which must be larger than 1/M |
col |
color of the main graphs |
The basic function of the script, and the default setting, is to remove frequencies above 1/20 (and, in particular, the seasonal frequency of 1 cycle every 12 time points). The sampling frequency of the time series is set to unity prior to the analysis.
Returned invisibly as a list
series.filt |
[[1]] the filtered series |
filter |
[[2]] the filter |
Also prints the rounded filter coefficients and returns plots of (1) the original and filtered series, (2) the estimated spectra of each series, (3) the filter coefficients and the desired and attained frequency response function.
The script is based on code that was contributed by Professor Doug Wiens, Department of Mathematical and Statistical Sciences, University of Alberta.
D.S. Stoffer
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
## Not run: SigExtract(detrend(soi)) -> u tsplot(cbind(soi.filtered=u[[1]], detrend(soi)), col=4*1:2, lwd=2:1, spag=TRUE, addLegend=TRUE) ## End(Not run)## Not run: SigExtract(detrend(soi)) -> u tsplot(cbind(soi.filtered=u[[1]], detrend(soi)), col=4*1:2, lwd=2:1, spag=TRUE, addLegend=TRUE) ## End(Not run)
Sleep-state and number of movements of infants taken from a study on the effects of prenatal exposure to alcohol. This is Group 1 where the mothers did not drink alcohol during pregnancy.
List of 12 (by subjects) :'data.frame': 120 obs. of 3 variables: .. min : int [1:120] minute (1 to 120) .. state: int [1:120] sleep state 1 to 6 with NA missing (see details) .. mvmnt: int [1:120] number of movements
Per minute sleep state, for approximately 120 minutes, is categorized into one of six possible states, non-REM: NR1 [1] to NR4 [4], and REM [5], or AWAKE [6]. NA means no state is recorded for that minute (if there, it occurs at end of the session). Group 1 (this group) is from mothers who abstained from drinking during pregnancy. In addition, the number of movements per minute are listed.
Stoffer, D. S., Scher, M. S., Richardson, G. A., Day, N. L., Coble, P. A. (1988). A Walsh-Fourier Analysis of the Effects of Moderate Maternal Alcohol Consumption on Neonatal Sleep-State Cycling. Journal of the American Statistical Association, 83(404), 954-963. https://doi.org/10.2307/2290119
Stoffer, D. S. (1990). Multivariate Walsh-Fourier Analysis. Journal of Time Series Analysis, 11(1), 57-73. https://doi.org/10.1111/j.1467-9892.1990.tb00042.x
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
# spectral analysis x = dna2vector(sleep1[[1]]$state, alphabet=c('1','2','3','4','5')) # never awake specenv(na.omit(x), spans=c(3,3), col=5) # not all babies make it to 120 minutes abline(v=1/60, lty=2, col=8) mtext(side=1, '1/60', at=1/60, cex=.75)# spectral analysis x = dna2vector(sleep1[[1]]$state, alphabet=c('1','2','3','4','5')) # never awake specenv(na.omit(x), spans=c(3,3), col=5) # not all babies make it to 120 minutes abline(v=1/60, lty=2, col=8) mtext(side=1, '1/60', at=1/60, cex=.75)
Sleep-state and number of movements of infants taken from a study on the effects of prenatal exposure to alcohol. This is Group 2 where the mothers drank alcohol in moderation during pregnancy.
List of 12 (by subjects) :'data.frame': 120 obs. of 3 variables: .. min : int [1:120] minute (1 to 120) .. state: int [1:120] sleep state 1 to 6 with NA missing (see details) .. mvmnt: int [1:120] number of movements
Per minute sleep state, for approximately 120 minutes, is categorized into one of six possible states, non-REM: NR1 [1] to NR4 [4], and REM [5], or AWAKE [6]. NA means no state is recorded for that minute (if there, it occurs at end of the session). Group 2 (this group) is from mothers who drank alcohol in moderation during pregnancy. In addition, the number of movements per minute are listed.
Stoffer, D. S., Scher, M. S., Richardson, G. A., Day, N. L., Coble, P. A. (1988). A Walsh-Fourier Analysis of the Effects of Moderate Maternal Alcohol Consumption on Neonatal Sleep-State Cycling. Journal of the American Statistical Association, 83(404), 954-963. https://doi.org/10.2307/2290119
Stoffer, D. S. (1990). Multivariate Walsh-Fourier Analysis. Journal of Time Series Analysis, 11(1), 57-73. https://doi.org/10.1111/j.1467-9892.1990.tb00042.x
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
tsplot(sleep2[[1]][,1], sleep2[[1]][,2:3], type='s', col=2*2:3, xlab='minute') title('Baby Goo from Group 2', outer=TRUE, line=-1, cex.main=1)tsplot(sleep2[[1]][,1], sleep2[[1]][,2:3], type='s', col=2*2:3, xlab='minute') title('Baby Goo from Group 2', outer=TRUE, line=-1, cex.main=1)
Sulfur dioxide levels from the LA pollution study
The format is: Time-Series [1:508] from 1970 to 1980: 3.37 2.59 3.29 3.04 3.39 2.57 2.35 3.38 1.5 2.56 ...
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
Southern Oscillation Index (SOI) for a period of 453 months ranging over the years 1950-1987.
The format is: Time-Series [1:453] from 1950 to 1988: 0.377 0.246 0.311 0.104 -0.016 0.235 0.137 0.191 -0.016 0.29 ...
pairs with rec (Recruitment)
Data furnished by Dr. Roy Mendelssohn of the Pacific Fisheries Environmental Laboratory, NOAA (personal communication).
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
A 64 by 36 matrix of surface soil temperatures ().
The format is: num [1:64, 1:36] 6.7 8.9 5 6.6 6.1 7 6.5 8.2 6.7 6.6 ...
Bazza, M., Shumway, R. H., & Nielsen, D. R. (1988). Two-dimensional spectral analysis of soil surface temperature. Hilgardia: A Journal of Agricultural Science, 56, 1-28.
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
par(mar = rep(1,4)) persp(1:64, 1:36, soiltemp, phi=25, theta=25, scale=FALSE, expand=4, col='lightblue', border=4, ticktype="detailed", xlab="rows", ylab="columns", zlab="temperature")par(mar = rep(1,4)) persp(1:64, 1:36, soiltemp, phi=25, theta=25, scale=FALSE, expand=4, col='lightblue', border=4, ticktype="detailed", xlab="rows", ylab="columns", zlab="temperature")
Daily growth rate of the S&P 500 from 2001 though 2011.
The format is: Time Series; Start = c(2001, 2); End = c(2011, 209); Frequency = 252
Douc, Moulines, & Stoffer (2014). Nonlinear Time Series: Theory, Methods and Applications with R Examples. CRC Press. doi:10.1201/b16331.
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
Weekly closing returns of the SP 500 from 2003 to September, 2012.
An 'xts' object on 2003-01-03 to 2012-09-28; Indexed by objects of class: [Date] TZ: UTC
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
# if 'xts' is not loaded, you can do this par(mfrow=2:1) tsplot(sp500w, col=4, lwd=2) # no dates tsplot(timex(sp500w), sp500w, col=4, lwd=2) # dates# if 'xts' is not loaded, you can do this par(mfrow=2:1) tsplot(sp500w, col=4, lwd=2) # no dates tsplot(timex(sp500w), sp500w, col=4, lwd=2) # dates
Fits an AR model to data and computes (and by default plots) the spectral density of the fitted model based on AIC (default) or BIC.
spec.ic(xdata, BIC=FALSE, order.max=NULL, main=NULL, plot=TRUE, detrend=TRUE, lowess=FALSE, method=NULL, cex.main=NULL, xlab=NULL, ...)spec.ic(xdata, BIC=FALSE, order.max=NULL, main=NULL, plot=TRUE, detrend=TRUE, lowess=FALSE, method=NULL, cex.main=NULL, xlab=NULL, ...)
xdata |
a univariate time series. |
BIC |
if TRUE, fit is based on BIC. If FALSE (default), fit is based on AIC. |
order.max |
maximum order of model to fit. Defaults (if NULL) to the minimum of 100 and 10% of the number of observations. |
main |
plot title. Defaults to name of series, method and chosen order. |
plot |
if TRUE (default) produces a graphic of the estimated AR spectrum. |
detrend |
if TRUE (default), detrends the data first. If FALSE, the series is demeaned. |
lowess |
if TRUE, detrends using lowess. Default is FALSE. |
method |
method of estimation - a character string specifying the method to fit the model chosen from the following: "yule-walker", "burg", "ols", "mle", "yw". Defaults to "yule-walker". |
cex.main |
magnification for main title; default is 1. |
xlab |
label for frequency axis; if NULL (default), a totally awesome label is generated for your viewing pleasure. |
... |
additional graphical arguments. |
Uses ar to fit the best AR model based on pseudo AIC or BIC.
Using method='mle' will be slow. The minimum centered AIC and BIC values and the
spectral and frequency ordinates are returned silently.
[[1]] |
Matrix with columns: ORDER, AIC, BIC |
[[2]] |
Matrix with columns: freq, spec |
D.S. Stoffer
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
# AIC dog <- spec.ic(soi) # put results in dog # plot AIC and BIC tsplot(dog[[1]][,2:3], col=2*1:2, type='o', pch=1:2, xlab='order', spag=TRUE, addLegend=TRUE)# AIC dog <- spec.ic(soi) # put results in dog # plot AIC and BIC tsplot(dog[[1]][,2:3], col=2*1:2, type='o', pch=1:2, xlab='order', spag=TRUE, addLegend=TRUE)
Computes the spectral envelope of categorical-valued or real-valued time series.
specenv(xdata, section = NULL, spans = NULL, kernel = NULL, taper = 0, significance = 1e-04, plot = TRUE, ylim = NULL, real = FALSE, ...)specenv(xdata, section = NULL, spans = NULL, kernel = NULL, taper = 0, significance = 1e-04, plot = TRUE, ylim = NULL, real = FALSE, ...)
xdata |
For categorical-valued sequences, a matrix with rows that are indicators
of the categories represented by the columns, possibly a sequence converted using
|
section |
of the form |
spans |
specify smoothing used in |
kernel |
specify kernel to be used in |
taper |
specify amount of tapering to be used in |
significance |
significance threshold exhibited in plot - default is .0001; set to NA to cancel |
plot |
if TRUE (default) a graphic of the spectral envelope is produced |
ylim |
limits of the spectral envelope axis; if NULL (default), a suitable range is calculated. |
real |
FALSE (default) for categorical-valued sequences and TRUE for real-valued sequences. |
... |
other graphical parameters. |
Calculates the spectral envelope for categorical-valued series as discussed in
https://www.stat.pitt.edu/stoffer/dss_files/spenv.pdf
and summarized in
https://doi.org/10.1214/ss/1009212816.
Alternately, calculates the spectral envelope for real-valued series as discussed in
https://doi.org/10.1016/S0378-3758(96)00044-4.
These concepts are also presented (with examples) in Section 7.9 (Chapter 7) of Time Series Analysis and Its Applications: With R Examples: https://www.stat.pitt.edu/stoffer/tsa4/.
For categorical-valued series, the input xdata must be a matrix of indicators which is perhaps a sequence preprocessed using dna2vector.
For real-valued series, the input xdata should be a matrix whose columns are various transformations of the univariate series.
The script does not detrend the data prior to estimating spectra. If this is an issue, then detrend the data prior to using this script.
By default, will produce a graph of the spectral envelope and an approximate significance threshold. A matrix containing: frequency, spectral envelope ordinates, and (1) the scalings of the categories in the order of the categories in the alphabet or (2) the coefficients of the transformations, is returned invisibly.
D.S. Stoffer
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
# a DNA sequence data = bnrf1ebv xdata = dna2vector(data) u = specenv(xdata, section=1:1000, spans=c(7,7)) head(u) # scalings are for A, C, G, and last one T=0 always # a real-valued series x = astsa::nyse xdata = cbind(x, abs(x), x^2) u = specenv(xdata, real=TRUE, spans=c(3,3)) # plot optimal transform at freq = .001 beta = u[2, 3:5] ( b = beta/beta[2] ) # makes abs(x) coef=1 gopt = function(z) { b[1]*z + b[2]*abs(z) + b[3]*z^2 } gabs = function(z) { abs(z) } z = -20:20/100 tsplot(z, cbind(gopt(z), gabs(z)), spag=TRUE, col=5:6, addLegend=TRUE, lwd=2, xlab='return', legend = c('optimal','absolute value' ), gg=TRUE) title('transformations')# a DNA sequence data = bnrf1ebv xdata = dna2vector(data) u = specenv(xdata, section=1:1000, spans=c(7,7)) head(u) # scalings are for A, C, G, and last one T=0 always # a real-valued series x = astsa::nyse xdata = cbind(x, abs(x), x^2) u = specenv(xdata, real=TRUE, spans=c(3,3)) # plot optimal transform at freq = .001 beta = u[2, 3:5] ( b = beta/beta[2] ) # makes abs(x) coef=1 gopt = function(z) { b[1]*z + b[2]*abs(z) + b[3]*z^2 } gabs = function(z) { abs(z) } z = -20:20/100 tsplot(z, cbind(gopt(z), gabs(z)), spag=TRUE, col=5:6, addLegend=TRUE, lwd=2, xlab='return', legend = c('optimal','absolute value' ), gg=TRUE) title('transformations')
A small .1 second (1000 points) sample of recorded speech for the phrase "aaa...hhh".
The format is: Time-Series [1:1020] from 1 to 1020: 1814 1556 1442 1416 1352 ...
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
Fits a simple univariate state space model to data. The parameters are estimated (the state regression parameter may be fixed). State predictions, filters, and smoothers and corresponding error variances are evaluated at the estimates. The sample size must be at least 20.
ssm(y, A, phi, alpha, sigw, sigv, fixphi = FALSE)ssm(y, A, phi, alpha, sigw, sigv, fixphi = FALSE)
y |
data |
A |
measurement value (fixed constant) |
phi |
initial value of phi, may be fixed |
alpha |
initial value for alpha |
sigw |
initial value for sigma[w] |
sigv |
initial value for sigma[v] |
fixphi |
if TRUE, the phi parameter is fixed |
The script works for a specific univariate state space model,
The initial state conditions use a default calculation and cannot be specified.
The parameter estimates are printed and the script returns the state predictors and
smoothers. The regression parameter may be fixed.
At the MLEs, these are returned invisibly:
Xp |
time series - state prediction, |
Pp |
corresponding MSPEs, |
Xf |
time series - state filter, |
Pf |
corresponding MSEs, |
Xs |
time series - state smoother, |
Ps |
corresponding MSEs, |
D.S. Stoffer
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
## Not run: u = ssm(gtemp_land, A=1, alpha=.01, phi=1, sigw=.05, sigv=.15, fixphi=TRUE) tsplot(gtemp_land, type='o', col=4) lines(u$Xs, col=6, lwd=2) ## End(Not run)## Not run: u = ssm(gtemp_land, A=1, alpha=.01, phi=1, sigw=.05, sigv=.15, fixphi=TRUE) tsplot(gtemp_land, type='o', col=4) lines(u$Xs, col=6, lwd=2) ## End(Not run)
The magnitude of a star taken at midnight for 600 consecutive days.
The format is: Time-Series [1:600] from 1 to 600: 25 28 31 32 33 33 32 ...
The data are taken from the classic text, The Calculus of Observations, a Treatise on Numerical Mathematics, by E.T. Whittaker and G. Robinson, (1923, Blackie and Son, Ltd.).
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
Performs frequency domain stochastic regression discussed in Chapter 7.
stoch.reg(xdata, cols.full, cols.red=NULL, alpha, L, M, plot.which, col.resp=NULL, ...)stoch.reg(xdata, cols.full, cols.red=NULL, alpha, L, M, plot.which, col.resp=NULL, ...)
xdata |
data matrix with the last column being the response variable |
cols.full |
specify columns of data matrix that are in the full model |
cols.red |
specify columns of data matrix that are in the reduced model (use NULL if there are no inputs in the reduced model) |
alpha |
test size; number between 0 and 1 |
L |
odd integer specifying degree of smoothing |
M |
number (integer) of points in the discretization of the integral |
plot.which |
|
col.resp |
specify column of the response variable if it is not the last column of the data matrix |
... |
additional graphic arguments |
This function computes the spectral matrix, F statistics and coherences, and plots them. Returned as well are the coefficients in the impulse response function.
Enter, as the argument to this function, the full data matrix, and then the labels of the columns of input series in the "full" and "reduced" regression models - enter NULL if there are no inputs under the reduced model.
If the response variable is the LAST column of the data matrix, it need not be specified. Otherwise specify which column holds the responses as col.resp.
Other inputs are alpha (test size), L (smoothing), M (number of points in the discretization of the integral) and plot.which = "coh" or "F", to plot either the coherences or the F statistics.
power.full |
spectrum under the full model |
power.red |
spectrum under the reduced model |
Betahat |
regression parameter estimates |
eF |
pointwise (by frequency) F-tests |
coh |
coherency |
See Example 7.1 of the text. The script is based on code that was contributed by Professor Doug Wiens, Department of Mathematical and Statistical Sciences, University of Alberta.
D.S. Stoffer
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
Biannual smoothed (12-month moving average) number of sunspots from June 1749 to December 1978; n = 459.
The format is: Time Series: Start = c(1749, 1) End = c(1978, 1) Frequency = 2
The "z" on the end of sunspotz is to distinguish this series from the ones included with R (see sunspots).
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
Fits a stochastic volatility model to a univariate time series of returns.
SV.mcmc(y, nmcmc = 1000, burnin = 100, init = NULL, hyper = NULL, tuning = NULL, sigma_MH = NULL, npart = NULL, mcmseed = NULL)SV.mcmc(y, nmcmc = 1000, burnin = 100, init = NULL, hyper = NULL, tuning = NULL, sigma_MH = NULL, npart = NULL, mcmseed = NULL)
y |
single time series of returns |
nmcmc |
number of iterations for the MCMC procedure |
burnin |
number of iterations to discard for the MCMC procedure |
init |
initial values of (phi, sigma, beta) - default is |
hyper |
hyperparameters for bivariate normal distribution of (phi, sigma); user inputs (mu_phi, mu_q, sigma_phi, sigma_q, rho) -
default is |
tuning |
tuning parameter - default is |
sigma_MH |
covariance matrix used for random walk Metropolis; it will be scaled by |
npart |
number of particles used in particle filter - default is |
mcmseed |
seed for mcmc - default is |
The log-volatility process is and the returns are . The SV model is
where and are independent standard normal white noise.
The model is fit using a technique described in the paper listed below (in the Source section) where the state
parameters are sampled simultaneously with a bivariate normal prior specified
in the arguments init and hyper.
Two graphics are returned: (1) the three parameter traces with the posterior mean highlighted, their ACFs [with effective sample sizes (ESS)], and their histograms with the .025, .5, and .975 quantiles displayed, and (2) the log-volatility posterior mean along with corresponding .95 credible intervals.
Returned invisibly as a list:
phi |
[[1]] vector of sampled state AR parameter |
sigma |
[[2]] vector of sampled state error stnd deviation |
beta |
[[3]] vector of sampled observation error scale |
log.vol |
[[4]] matrix of sampled log-volatility |
options |
[[5]] values of the input arguments |
Except for the data, all the other inputs have defaults. The time to run and the acceptance rate are returned at the end of the analysis. The acceptance rate should be around 30% and this is easily adjusted using the tuning parameter.
D.S. Stoffer
Gong & Stoffer (2021). A note on efficient fitting of stochastic volatility models. Journal of Time Series Analysis, 42(2), 186-200. https://github.com/nickpoison/Stochastic-Volatility-Models
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
## Not run: #-- A minimal example --## myrun <- SV.mcmc(sp500w) # results in object myrun - don't forget it str(myrun) # an easy way to see the default input options ## End(Not run)## Not run: #-- A minimal example --## myrun <- SV.mcmc(sp500w) # results in object myrun - don't forget it str(myrun) # an easy way to see the default input options ## End(Not run)
Fits a stochastic volatility model with feedback (optional) to a univariate time series of returns via quasi-MLE.
SV.mle(returns, gamma = 0, phi = 0.95, sQ = 0.1, alpha = NULL, sR0 = 1, mu1 = -3, sR1 = 2, rho = NULL, feedback = FALSE)SV.mle(returns, gamma = 0, phi = 0.95, sQ = 0.1, alpha = NULL, sR0 = 1, mu1 = -3, sR1 = 2, rho = NULL, feedback = FALSE)
returns |
single time series of returns |
gamma |
feedback coefficient - included if |
phi |
initial value of the log-volatility AR parameter (does not have to be specified) |
sQ |
initial value of the standard deviation of log-volatility noise (does not have to be specified) |
alpha |
initial value of the log-returns^2 constant parameter (does not have to be specified) |
sR0 |
initial value of the log-returns^2 normal mixture standard deviation parameter (component 0 - does not have to be specified) |
mu1 |
initial value of the log-returns^2 normal mixture mean parameter (component 1 - does not have to be specified) |
sR1 |
initial value of the log-returns^2 normal mixture standard deviation parameter (component 1 - does not have to be specified) |
rho |
correlation between the state noise and observation noise (so called "leverage"). If |
feedback |
if TRUE feedback is included in the model; default is FALSE. |
The returns are (input this).
The log-volatility process is and
.
If feedback=TRUE, the model is
where is standard normal noise. The observation error is a mixture of
two normals, and . The state
and observation noise can be correlated if is given a value between -1 and 1.
If feedback=FALSE, and are not included in the model.
Returned invisibly:
PredLogVol |
one-step-ahead predicted log-volatility |
RMSPE |
corresponding root MSPE |
Coefficients |
table of estimates and estimated standard errors |
In addition to the one step ahead predicted log-volatility, corresponding root MSPE, and table of estimates returned invisibly, the estimates and SEs are printed and a graph of (1) the data with the predicted log-volatility, and (2) the normal mixture are displayed in one graphic.
D.S. Stoffer
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
## Not run: SV.mle(sp500.gr, feedback=TRUE) SV.mle(nyse) ## End(Not run)## Not run: SV.mle(sp500.gr, feedback=TRUE) SV.mle(nyse) ## End(Not run)
Temperature series corresponding to cmort from the LA pollution study.
The format is: Time-Series [1:508] from 1970 to 1980: 72.4 67.2 62.9 72.5 74.2 ...
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
Produces a plot of the tail probabilities of a normalized bispectrum of a series under the assumption the model is a linear process with iid innovations.
test.linear(series, color = TRUE, detrend = FALSE, main = NULL)test.linear(series, color = TRUE, detrend = FALSE, main = NULL)
series |
the time series (univariate only) |
color |
if FALSE, the graphic is produced in gray scale |
detrend |
if TRUE, the series is detrended first |
main |
if NULL (default), a very nice title is chosen for the plot |
prob |
matrix of tail probabilities - returned invisibly |
The null hypothesis is that the data are from a linear process with i.i.d. innovations. Under the null hypothesis, the bispectrum is constant over all frequencies. Chi-squared test statistics are formed in blocks to measure departures from the null hypothesis and the corresponding p-values are displayed in a graphic and returned invisibly. Details are in Hinich, M. and Wolinsky, M. (2005). Normalizing bispectra. Journal of Statistical Planning and Inference, 130, 405–411.
D.S. Stoffer
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
test.linear(nyse) # :( test.linear(soi) # :)test.linear(nyse) # :( test.linear(soi) # :)
Takes an 'xts' data file, extracts the dates and converts them to decimal dates without having to have the 'xts' package loaded.
timex(xts.object)timex(xts.object)
xts.object |
an 'xts' data object |
For a data file made using the 'xts' package, this will produce a vector of decimal dates corresponding to the date of each observation even if 'xts' is not loaded. The script is a converter from 'unix time stamp' to decimal dates. For example, the unix time stamp of 2016-04-20 at 00:00:00 UTC is 1461110400. This will be converted to 2016.301 because 2016 was a leap year and April 20 is day 110 of the year using zero-based indexing (Jan 1 is day 0). Thus its decimal date is 2016 + (110/366).
The input object must be an 'xts' object. Note that if dog is an 'xts' data file with columns of time series, dog[,2] is NOT unless 'xts' is loaded. Thus, t <- timex(dog) will work but t <- timex(dog[,2]) may not.
A vector of decimal dates is returned invisibly.
We recommend the installation of 'xts' if you are working with time series, but we wanted to have an "option out" in the off chance that it can't (or won't) be installed.
D.S. Stoffer
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
tsplot(timex(lap.xts), lap.xts[,'Cmort'], col=4, ylab=NA, gg=TRUE) title('Daily Cardiovascular Mortality') DJIA = ts(djia[,'Close']) x = cbind(DJIA, Return = diff(log(DJIA))) tsplot(timex(djia), x, col=5, main="What, Me Worry?")tsplot(timex(lap.xts), lap.xts[,'Cmort'], col=4, ylab=NA, gg=TRUE) title('Daily Cardiovascular Mortality') DJIA = ts(djia[,'Close']) x = cbind(DJIA, Return = diff(log(DJIA))) tsplot(timex(djia), x, col=5, main="What, Me Worry?")
Estimates the trend (polynomial or lowess) of a time series and returns a graphic of the series with the trend and error bounds (returned invisibly) superimposed.
trend(series, order = 1, lowess = FALSE, lowspan = .75, robust = TRUE, col = c(4, 6), ylab = NULL, ci = TRUE, results = FALSE, ...)trend(series, order = 1, lowess = FALSE, lowspan = .75, robust = TRUE, col = c(4, 6), ylab = NULL, ci = TRUE, results = FALSE, ...)
series |
The time series to be analyzed (univariate only). |
order |
Order of the polynomial used to estimate the trend with a linear default (order=1) unless |
lowess |
If TRUE, |
lowspan |
The smoother span used for lowess. |
robust |
If TRUE (default), the lowess fit is robust. |
col |
Vector of two colors for the graphic, first the color of the data (default is blue [4]) and second the color of the trend (default is magenta [6]). Both the data and trend line will be the same color if only one value is given. |
ylab |
Label for the vertical axis (default is the name of the series). |
ci |
If TRUE (default), pointwise 95% confidence intervals are drawn. |
results |
For polynomial regression, if TRUE, will print a summary (using |
... |
Other graphical parameters. |
Produces a graphic of the time series with the trend and a .95 pointwise confidence interval superimposed. The trend estimate and the error bounds are returned invisibly.
Produces a graphic and returns the trend estimate fit and error bounds lwr and upr invisibly (see details) and with the same time series attributes as the input series.
D.S. Stoffer
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
par(mfrow=2:1) trend(soi, results=TRUE) trend(soi, lowess=TRUE, gg=TRUE)par(mfrow=2:1) trend(soi, results=TRUE) trend(soi, lowess=TRUE, gg=TRUE)
Produces a matrix of scatterplots with the time series (or a histogram) plotted on the diagonal.
tspairs(x, main = NA, pt.col = astsa.col(4, 0.6), pt.size = 1.1, lab.size = 1.25, title.size = 1.5, scale = 1, corr = TRUE, smooth = TRUE, lwl = 1, lwc = 2, gg = FALSE, hist.diag = TRUE, col.diag = 4, location='topright', ...)tspairs(x, main = NA, pt.col = astsa.col(4, 0.6), pt.size = 1.1, lab.size = 1.25, title.size = 1.5, scale = 1, corr = TRUE, smooth = TRUE, lwl = 1, lwc = 2, gg = FALSE, hist.diag = TRUE, col.diag = 4, location='topright', ...)
x |
multiple time series; use |
main |
title (default is no title). |
pt.col |
point color. |
pt.size |
point size. |
lab.size |
label size. |
title.size |
title size. |
scale |
multiplier for the overall character expansion ( |
corr |
if TRUE (default), the correlations are shown in the scatterplots. |
smooth |
if TRUE (default), a lowess fit is displayed in the scatterplots. |
lwl |
width of the lowess line. |
lwc |
color of the lowess line. |
gg |
if TRUE, will produce a gris-gris plot (gray graphic interior with white grid lines); the default is FALSE. The grammar of astsa is voodoo. |
hist.diag |
if TRUE (default), will plot histograms on the diagonal; if FALSE, time plots of the series are displayed instead. |
col.diag |
color for the diagonal plots. |
location |
the location of the ACF legend with options |
... |
additional graphic parameters. |
Returns a matrix of scatterplots with time plots or histograms on the diagonal.
Use lag1.plot and lag2.plot for lag plots. But if some lagged variables are included, use ts.intersect. If there are no lagged variables, cbind will work to combine individual series.
D.S. Stoffer
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
tspairs(diff(log(econ5))[,1:3], col.diag=6, hist=FALSE, pt.size=1.5, lwl=2, gg=TRUE) tspairs(ts.intersect(MEI, MEI2), location='top')tspairs(diff(log(econ5))[,1:3], col.diag=6, hist=FALSE, pt.size=1.5, lwl=2, gg=TRUE) tspairs(ts.intersect(MEI, MEI2), location='top')
Produces a nice plot of univariate or multiple time series in one easy line.
tsplot(x, y=NULL, main=NULL, ylab=NULL, xlab=NULL, title=NULL, type=NULL, margins=.25, omargins=0, ncolm=1, byrow=TRUE, nx=NULL, ny=nx, minor=TRUE, nxm=2, nym=1, xm.grid=TRUE, ym.grid=TRUE, col=1, gg=FALSE, spaghetti=FALSE, pch=NULL, lty=1, lwd=1, mgpp=0, topper=NULL, addLegend=FALSE, location='topright', boxit=TRUE, horiz=FALSE, legend=NULL, llwd=NULL, scale=1, reset.par = TRUE, ...)tsplot(x, y=NULL, main=NULL, ylab=NULL, xlab=NULL, title=NULL, type=NULL, margins=.25, omargins=0, ncolm=1, byrow=TRUE, nx=NULL, ny=nx, minor=TRUE, nxm=2, nym=1, xm.grid=TRUE, ym.grid=TRUE, col=1, gg=FALSE, spaghetti=FALSE, pch=NULL, lty=1, lwd=1, mgpp=0, topper=NULL, addLegend=FALSE, location='topright', boxit=TRUE, horiz=FALSE, legend=NULL, llwd=NULL, scale=1, reset.par = TRUE, ...)
x, y
|
time series to be plotted; if both present, x will be the time index. |
main |
add a main title - the default is no title. |
ylab |
y-axis label - the default is the name of the ts object. |
xlab |
x-axis label - the default is 'Time'. |
title |
add an individual plot title for multiple plots - the default is no title. |
type |
type of plot - the default is line. |
margins |
inches to add (or subtract) to the margins. Input one value to apply to all margins or a vector of length 4 to add (or subtract) to the (bottom, left, top, right) margins. |
omargins |
inches to add to the outer margins. Input one value to apply to all margins or a vector of length 4 to add to the (bottom, left, top, right) outer margins. |
ncolm |
for multiple time series, the number of columns to plot. |
byrow |
for multiple time series - if TRUE (default), plot series row wise; if FALSE, plot series column wise. |
nx, ny
|
number of major cells of the grid in x and y direction. When NULL, as per default, the grid aligns with the tick marks on the corresponding default axis (i.e., tickmarks as computed by axTicks). When NA, no grid lines are drawn in the corresponding direction. |
minor, nxm, nym
|
if minor=TRUE, the number of minor tick marks on x-axis, y-axis. minor=FALSE removes both or set either to 0 or 1 to remove. The default is one minor tick on the x-axis and none on the y-axis. |
xm.grid, ym.grid
|
if TRUE (default), adds grid lines at minor x-axis, y-axis ticks. |
col |
line color(s), can be a vector for multiple time series. |
gg |
if TRUE, will produce a gris-gris plot (gray graphic interior with white grid lines); the default is FALSE.
The grammar of astsa is voodoo; see |
spaghetti |
if TRUE, will produce a spaghetti plot (all series on same plot). |
pch |
plot symbols (default is 1, circle); can be a vector for multiple plots. |
lty |
line type (default is 1, solid line); can be a vector for multiple plots. |
lwd |
line width (default is 1); can be a vector for multiple plots. |
mgpp |
this is used to adjust (add to) the |
topper |
non-negative value to add to the top outer margin; if NULL (default) a suitable value is chosen |
addLegend |
if TRUE and |
location |
if |
boxit |
if TRUE (default), the legend is in a box; if FALSE, no box is drawn. |
horiz |
if |
legend |
if NULL (default), the legend uses names of each time series; otherwise, use to customize legend. |
llwd |
line width for the legend if different from the plotted lines. |
scale |
for multiple series, the scale for character expansion. |
reset.par |
logical; for multiple series, should the graphics parameters be reset after plotting. |
... |
other graphical parameters; see par. |
Produces a graphic and returns it invisibly so it can be saved in an R variable with the ability to replay it; see recordPlot.
A legend can be added using addLegend=TRUE for spaghetti plots only. Spaghetti plots work if spaghetti=TRUE and there is more than one series being plotted.
For multiple series, the default for reset.par is TRUE so that the graphic parameters are reset at the end. For example, if there are 5 plots and ncol = 2, the layout will be 3 rows, 2 columns, with an empty spot where a 6th plot would be. If you want to add something in the empty space, set this to FALSE, otherwise the graphic parameters are reset and the graphic is finished.
The scale setting is to make sure that axis labels do not get too small for large multifigure plots. While small text can be decent on a screen, it can be too small for publication. The default setting is scale=1 with larger/smaller values giving larger/smaller text.
D.S. Stoffer
This is simply base-R plotting of time series with some bells and whistles, and written so that a nice plot can be used in demonstrations (in class or otherwise) with minimal keystrokes.
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
lag1.plot, lag2.plot, tspairs,
timex for plotting xts data files when xts is not loaded
## Not run: # minimal tsplot(soi) # gris-gris spaghetti tsplot(cbind(MEI, MEI2), spaghetti=TRUE, col=2*2:1, addLegend=TRUE, nym=2, gg=TRUE) # gris-gris multiple plot tsplot(diff(log(econ5)), ncolm=2, gg=TRUE, col=2:6, lwd=2, main='Growth Rates') # plotting is row-wise unless byrow=FALSE is included tsplot(climhyd, ncolm=2, gg=TRUE, col=2:7, lwd=2, xlab=c(rep(NA,4), rep('Time',2)), scale=.85, ylab=NA, title=colnames(climhyd), las=1) # missing data - try this with ggplot tsplot(blood, type='o', col=c(4,6,3), pch=19, scale=.95, gg=TRUE, title = colnames(blood), xlab = c(NA, NA,'day'), ylab = c( 'log(cells/\u03BCL)', 'log(\u03BCL)', '\u0025 red blood cells' )) ## End(Not run)## Not run: # minimal tsplot(soi) # gris-gris spaghetti tsplot(cbind(MEI, MEI2), spaghetti=TRUE, col=2*2:1, addLegend=TRUE, nym=2, gg=TRUE) # gris-gris multiple plot tsplot(diff(log(econ5)), ncolm=2, gg=TRUE, col=2:6, lwd=2, main='Growth Rates') # plotting is row-wise unless byrow=FALSE is included tsplot(climhyd, ncolm=2, gg=TRUE, col=2:7, lwd=2, xlab=c(rep(NA,4), rep('Time',2)), scale=.85, ylab=NA, title=colnames(climhyd), las=1) # missing data - try this with ggplot tsplot(blood, type='o', col=c(4,6,3), pch=19, scale=.95, gg=TRUE, title = colnames(blood), xlab = c(NA, NA,'day'), ylab = c( 'log(cells/\u03BCL)', 'log(\u03BCL)', '\u0025 red blood cells' )) ## End(Not run)
lm object
Works like summary for an lm object but adds AIC, AICc, and BIC to the output with the option to display VIFs.
ttable(obj, digits = 4, vif = FALSE, ...)ttable(obj, digits = 4, vif = FALSE, ...)
obj |
an object of class "lm" as a result of a call to |
digits |
the (approximate) number of significant digits to use when printing. |
vif |
if TRUE, variance inflation factors are printed if applicable; default is FALSE. |
... |
further arguments passed to or from other methods. |
Produces a t-table for an lm object much like print.summary.lm with added information including AIC, AICc, BIC, and VIF (if requested and if applicable), to the output. The output is rounded and there are no significance stars. In fact, there are no stars at all.
TO REPEAT THE WARNING ON USING 'lm' FOR TIME SERIES: Considerable care must be taken:
Include na.action = NULL in the lm call to avoid stripping the time series attributes from the variables before the regression is done.
If any lagged or differenced variables are used in 'lm', the series must be lined up first. In this case, prepare a data frame using ts.intersect(..., dframe = TRUE); e.g.,
mydata = ts.intersect(M = cmort, P4 = lag(part,-4), dframe=TRUE) fit = lm(M ~ P4, na.action=NULL, data=mydata) ttable(fit)
Prints a typical t-table with additional information as mentioned in the details.
The p-values are two-sided. Also silently returns the same values as described in summary.lm.
D.S. Stoffer
Built using print.summary.lm from the 'stats' package.
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
summary.lm, print.summary.lm, lm
fit1 = lm(cmort~ time(cmort) + tempr + I(tempr^2)) ttable(fit1, vif=TRUE) # if you center `tempr`, the squared term doesn't change temp = tempr - mean(tempr) fit2 = lm(cmort~ time(cmort) + temp + I(temp^2)) ttable(fit2, vif=TRUE)fit1 = lm(cmort~ time(cmort) + tempr + I(tempr^2)) ttable(fit1, vif=TRUE) # if you center `tempr`, the squared term doesn't change temp = tempr - mean(tempr) fit2 = lm(cmort~ time(cmort) + temp + I(temp^2)) ttable(fit2, vif=TRUE)
Monthly U.S. Unemployment series (1948-1978, n = 372)
data(unemp)data(unemp)
The format is: Time-Series [1:372] from 1948 to 1979: 235 281 265 241 201 ...
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
Monthly U.S. unemployment rate in percent unemployed (Jan, 1948 - Nov, 2016, n = 827)
The format is: Time-Series [1:827] from 1948 to 2017: 4 4.7 4.5 4 3.4 3.9 3.9 3.6 3.4 2.9 ...
https://data.bls.gov/timeseries/LNU04000000/
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
U.S. Population by official census, every ten years from 1900 to 2010.
The format is: Time-Series [1:12] from 1900 to 2010: 76 92 106 123 132 ...
The census from 2020 is not included in this data set because, by many accounts, it was a nightmare (https://www.npr.org/2022/01/15/1073338121/2020-census-interference-trump) due to the COVID-19 pandemic coupled with the fact that the Census Bureau is in the Department of Commerce, and its head is appointed by and reports directly to the POTUS, who at the time was DJ tRump: "Historians rank Trump among worst presidents in US history ... " (https://www.businessinsider.com/historians-rank-trump-among-worst-presidents-us-history-c-span-2021-6).
The data with the 2020 census is in USpop20. Note that the two data files differ a bit, presumably because they are revised ad infinitum. Both data sets were obtained from the Census Bureau's website.
https://www.census.gov/
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
U.S. Population by official census, every ten years from 1900 to 2020, in millions.
The format is: Time-Series [1:13] from 1900 to 2020: 76.2 92.2 106 122.8 132.2 ...
The census from 2020 is included in this data set, but the results from 2020 are questionable. By many accounts, it was a nightmare (https://www.npr.org/2022/01/15/1073338121/2020-census-interference-trump) due to the COVID-19 pandemic coupled with the fact that the Census Bureau is in the Department of Commerce, and its head is appointed by and reports directly to the POTUS, who at the time was DJ tRump: "Historians rank Trump among worst presidents in US history ... " (https://www.businessinsider.com/historians-rank-trump-among-worst-presidents-us-history-c-span-2021-6).
The data without the 2020 census is in USpop. Note that the two data files differ a bit, presumably because they are revised ad infinitum. Both data sets were obtained from the Census Bureau's website.
https://www.census.gov/
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
# the regression t = time(USpop20) - 1960 reg = lm( USpop20~ poly(t, 10, raw=TRUE) ) # the prediction curve b = as.vector(coef(reg)) t = 1900:2044 X = outer(t - 1960, 0:10, FUN = "^") pred = X %*% b # the plot tsplot(t, pred, ylab="Population", xlab='Year', cex.main=1, col=4, main="U.S. Population by Official Census") points(time(USpop20), USpop20, pch=21, bg=rainbow(13), cex=1.25) mtext(bquote('\u00D7'~10^6), side=2, line=1.5, adj=1, cex=.8)# the regression t = time(USpop20) - 1960 reg = lm( USpop20~ poly(t, 10, raw=TRUE) ) # the prediction curve b = as.vector(coef(reg)) t = 1900:2044 X = outer(t - 1960, 0:10, FUN = "^") pred = X %*% b # the plot tsplot(t, pred, ylab="Population", xlab='Year', cex.main=1, col=4, main="U.S. Population by Official Census") points(time(USpop20), USpop20, pch=21, bg=rainbow(13), cex=1.25) mtext(bquote('\u00D7'~10^6), side=2, line=1.5, adj=1, cex=.8)
Sedimentary deposits from one location in Massachusetts for 634 years, beginning nearly 12,000 years ago.
The format is: Time-Series [1:634] from 1 to 634: 26.3 27.4 42.3 58.3 20.6 ...
Antevs, E. (1928). The Last Glaciation with Special Reference to the Ice Retreat in Northeastern North America. Amer. Geog. Soc. Res. Series, No. 17, 292p.
Shumway and Verosub (1992). State space modeling of paleoclimatic time series. Proceedings of the 5th International Meeting on Statistical Climatology, June, 1992, University of Toronto, 139p.
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.
WBC: Measurements made for 91 days on the three variables, log(white blood count) [WBC], log(platelet) [PLT] and hematocrit [HCT]. Missing data code is 0 (zero).
The format is: Time-Series [1:91] from 1 to 91: 2.33 1.89 2.08 1.82 1.82 ...
See Examples 6.1 and 6.9 for more details.
Jones, R.H. (1984). Fitting multivariate models to unequally spaced data. In Time Series Analysis of Irregularly Observed Data, pp. 158-188. E. Parzen, ed. Lecture Notes in Statistics, 25, New York: Springer-Verlag.
You can find demonstrations of astsa capabilities at FUN WITH ASTSA.
The most recent version of the package can be found at https://github.com/nickpoison/astsa/.
In addition, the News and ChangeLog files are at https://github.com/nickpoison/astsa/blob/master/NEWS.md.
The webpages for the texts and some help on using R for time series analysis can be found at https://nickpoison.github.io/.